We narrowed to 327 results for: IPTG
-
Plasmid#140693PurposeEncodes inducible expression of RhlI (C4-HSL quorum sensing synthase)DepositorInsertRhlI (rhlI )
TagsssrA degradation tag (ASV)ExpressionBacterialPromoterengineered lac promoter (IPTG inducible)Available SinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKB083
Plasmid#181952PurposeIPTG-inducible expression of PhoQDepositorInsertPhoQ; lacI (lacI PhoQ - Salmonella enterica subsp. enterica serovar Typhimurium; lacI - E. coli)
ExpressionBacterialPromoterPhoQ-Ptac; lacI-PlacIqAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEutRwc
Plasmid#216334PurposeAn IPTG-inducible promoter controlling expression of eutR; PEutS, extended controlling expression of sfgfpDepositorInsertsEutR
Superfolder green fluorescent protein
ExpressionBacterialAvailable SinceDec. 23, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pQE30del
Plasmid#106902PurposepQE30del is conditionally replicating empty vector. Replication of the plasmid is inhibited in presense of IPTG or lactose. pQE30del can be used for construction of any E. coli helper plasmids.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJune 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKD317.8
Plasmid#181951PurposeIPTG-inducible expression of NarXDepositorExpressionBacterialPromoterNarX-Ptac; lacI-PlacIqAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNVLTv2-pvdIJD-Ptrc-base
Plasmid#169243PurposeSuicide vector for integrating expression cassette in P. putida (IPTG induction)DepositorInsertlacI
ExpressionBacterialPromoterlacIqAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHnCB
Plasmid#52064Purposeexpresses nine genes from the H. neapolitanus carboxysome operon; IPTG-inducibleDepositorInsertCbbL, CbbS, CSOS2, CSOS3, CSOS4A, CSOS4B, CSOS1C, CSOS1A, CSOS1B
ExpressionBacterialAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMM763
Plasmid#68900PurposeIPTG-inducible CRISPRi vector targeting PcfiA (PR1), constiutive NanoLuc, pNBU2 backbone, AmpRDepositorInsertsdCas9
LacI
sgRNA
NanoLuc
MutationG1104EAvailable SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOPO636
Plasmid#195299PurposepACYC-plac-MycaTnsABCQ, lac promoter expressing transposase genes TnsABCQ of McCAST (Tn7575).DepositorInsertTnsABCQ operon of McCAST (Tn7575)
ExpressionBacterialPromoterIPTG inducible lac promoterAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMM725
Plasmid#68895PurposeIPTG-inducible CRISPRi vector targeting NanoLuc (NL3), constiutive NanoLuc, pNBU2 backbone, AmpRDepositorInsertsdCas9
LacI
sgRNA
NanoLuc
Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCas61
Plasmid#82397PurposeIPTG inducible, cLac143 (Markley 2015), LDH V39R with Gmr in glpKDepositorInsertLDH
MutationV39RPromotercLac143Available SinceOct. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
IDH1_WT
Plasmid#224142PurposeIPTG-inducible expression of C. elegans protein IDH-1 with a chitin tagDepositorAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
IDH1_G98N
Plasmid#224143PurposeIPTG-inducible expression of C. elegans protein IDH-1(G98N) with a chitin tagDepositorInsertIDH-1(G98N)
Tagsintein-CBDExpressionBacterialMutationG98NAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
IDH1_R133H
Plasmid#224144PurposeIPTG-inducible expression of C. elegans protein IDH-1(R133H) with a chitin tagDepositorInsertIDH-1(R133H)
Tagsintein-CBDExpressionBacterialMutationR133HAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOPO635
Plasmid#195297PurposepACYC-plac-MycaTnsABC, lac promoter expressing transposase genes TnsABC of McCAST (Tn7575).DepositorInsertTnsABC operon of McCAST (Tn7575)
ExpressionBacterialPromoterIPTG inducible lac promoterAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pO5
Plasmid#193749PurposeExpresses tdTomato under the control of PIAH synthetic promoter regulated by AHL and IPTG, p15A origin of replication, Chloramphenicol selectionDepositorInserttdTomato
ExpressionBacterialPromoterPIAHAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pO6
Plasmid#193747PurposeExpresses E2-Crimson under the control of PIAH synthetic promoter regulated by AHL and IPTG, p15A origin of replication, Chloramphenicol selection,DepositorInsertE2-Crimson
ExpressionBacterialPromoterPIAHAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNIC28-Bsa4
Plasmid#26103PurposeSGC Empty backbone for bacterial expressionDepositorTypeEmpty backboneTags6xHis and TEV cleavage siteExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available SinceOct. 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET15b-RvLEAMshort
Plasmid#218122PurposeExpresses truncated RvLEAM protein under IPTG induction in bacterial host cells.DepositorInsertRvLEAMshort
Tags6xHISExpressionBacterialMutationTruncated form (58-181aa)PromoterT7Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNH-TrxT
Plasmid#26106PurposeSGC Empty backbone for bacterial expressionDepositorTypeEmpty backboneTags6xHis, TEV cleavage site, and TrxAExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available SinceDec. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)::NL
Plasmid#141289PurposeNLUC in pET-28 a (+) backbone for bacterial IPTG inducible expression (KmR)DepositorInsertNLUC
UseLuciferaseExpressionBacterialMutationEngineered for high stability (t1/2 = 11.5 days a…Promoterpromoter for bacteriophage T7 RNA polymeraseAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYC01
Plasmid#224586PurposeIPTG-inducible phage φX174 lysis gene EDepositorInsertphage φX174 lysis gene E (phiX174p08 )
UseSynthetic BiologyExpressionBacterialPromoterPA1lacO-1Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)::NL3F10H
Plasmid#141290PurposeNLUC:3xFlag:10xHis in pET-28 a (+) backbone for bacterial IPTG inducible expression (KmR)DepositorInsertNLUC3F10H
UseLuciferaseTagsFlag (x3) and His (x10)ExpressionBacterialMutationEngineered for high stability (t1/2 = 11.5 days a…Promoterpromoter for bacteriophage T7 RNA polymeraseAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
DT044A
Plasmid#159405PurposeInducible Perfringolysin O (PFO) expression and purification, controlled under hybrid IPTG-regulated T7/LacO promoter (pRT30)DepositorInsertpr.T7-LacO-6xHis-PFO (Pfo, Clostridium perfringens)
UseSynthetic BiologyTags6xHisExpressionBacterialPromoterT7/LacO promoterAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTD-NTwinStrep_Km
Plasmid#45938Purposeuse to create N-terminal Twin-Strep-tag fusion proteins or dual tagged fusion with N-terminal Twin-Strep-tag and C-terminal 6x His-tagDepositorTypeEmpty backboneTags6xHis and Twin-StrepExpressionBacterialPromoterTrc (lactose/IPTG inducible)Available SinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFW2100
Plasmid#224212PurposeBacteroides genomic editing tool; IPTG inducible-Fncpf1DepositorInsertFncpf1
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTD-NTwinStrep_Sm
Plasmid#45937Purposeuse to create N-terminal Twin-Strep-tag fusion proteins or dual tagged fusion with N-terminal Twin-Strep-tag and C-terminal 6x His-tagDepositorTypeEmpty backboneTags6xHis and Twin-StrepExpressionBacterialPromoterTrc (lactose/IPTG inducible)Available SinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET11a-Z-NGFP
Plasmid#52734PurposeIPTG-inducible expression of Z-NGFP positive control for in vivo split GFP assembly assayDepositorInsertNGFP+Z-fusion
TagsHis tagExpressionBacterialPromoterT7Available SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMGA-ptac-sfGFP
Plasmid#139934PurposeIPTG-inducible sfGFP expression on M. magneticum/E. coli shuttle vectorDepositorInsertLacI-Ptac-sfGFP
ExpressionBacterialAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKPY514
Plasmid#62598PurposeEncodes Thr251Gly-EcPheRS Under IPTG-Inducible (PT5) ControlDepositorInsertThr251Gly-EcPheRS
Tags6xHisExpressionBacterialMutationThr251GlyPromoterT5Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET21a - NR
Plasmid#89625PurposeExpresses recombinant 6HIS tagged T. cruzi nitrate reductase in E. coli upon IPTG inductionDepositorInsertNitrate reductase
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_K3AK4A
Plasmid#202585PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the K3A and K4A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purification with a minimal scarDepositorInsertORF1p
Tags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Lysine 3 to Alanine, changed ORF1p …Available SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21a - GR
Plasmid#89614PurposeExpresses recombinant 6HIS tagged T. cruzi Glutathione reductase protein in E. coli upon IPTG inductionDepositorInsertGlutaredoxin
Tags6HISExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAAA
Plasmid#202587PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A, E92A, and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
Tags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, ORF1p Glu…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAEA
Plasmid#202588PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
Tags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, changed O…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a - TryX
Plasmid#89623Purpose[Edit] Expresses recombinant 6HIS tagged T. cruzi tryparedoxin protein in E. coli upon IPTG inductionDepositorInsertTryparedoxin
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCA24N-ligase
Plasmid#87741PurposeIPTG-inducible expression of T4 DNA ligase for protein purificationDepositorAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXD70LacZ6-LacI-Ptac(LacO)-LacZ
Plasmid#191621PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), IPTG-inducible promoter-lacZ, engineered from pMAL-c2XDepositorInsertlacZ
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R196A wgMDH
Plasmid#204271PurposeBacterial expression of R196A wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR196AAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R130A wgMDH
Plasmid#204266PurposeBacterial expression of R130A wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR130AAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R124A wgMDH
Plasmid#204257PurposeBacterial expression of R124A wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR124AAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTDpelB-NTwinStrep
Plasmid#45940Purposeuse to create N-terminal PelB-Twin-Strep-tag fusion proteins or dual tagged fusion with N-terminal PelB-Twin-Strep-tag and C-terminal 6x His-tag for periplasmic translocation via PelB signal sequenceDepositorTypeEmpty backboneTags6xHis, PelB, and Twin-StrepExpressionBacterialPromoterTrc (lactose/IPTG inducible)Available SinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQmod3C-GG
Plasmid#191350PurposeClostridium expression vector (pCB102 origin, cmR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQmod2C-GG
Plasmid#191347PurposeClostridium expression vector (pBP1 origin, cmR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJWV102-PL-dCas9
Plasmid#85588PurposeIntegrate plasmid of Streptococcus pneumoniae, for chromosome integration of IPTG-inducible dCas9spDepositorInsertdCas9sp
UseCRISPRExpressionBacterialPromoterPLspAvailable SinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFW2500
Plasmid#224213PurposeBacteroides genomic editing tool; IPTG inducible-Fncpf1 and recTDepositorInsertFncpf1 and recT
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQmod2S-GG
Plasmid#191346PurposeClostridium expression vector (pBP1 origin, specR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJAB988
Plasmid#133920PurposeminiICE-tet(M)cat(PC194)_PT7-GFP; used to integrate into JAB1000 B. subtilis XPORT strain with IPTG-inducible GFP under T7 promoterDepositorInsertminiICE-tet(M)cat(PC194)_PT7-GFP
UseSynthetic BiologyExpressionBacterialPromoterT7 promoterAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only