We narrowed to 13,839 results for: CRISPR-Cas9
-
Plasmid#246310PurposeEvaluation of PtU6.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.1 promoter
UseCRISPRExpressionPlantPromoterPtU6.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-1
Plasmid#246284PurposeEvaluation of AtU3b promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertAtU3b promoter
UseCRISPRExpressionPlantPromoterAtU3b promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-32
Plasmid#246315PurposeEvaluation of VvU6.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertVvU6.1 promoter
UseCRISPRExpressionPlantPromoterVvU6.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-23
Plasmid#246306PurposeEvaluation of a synthetic Pol III promoter based on the MtU6.6 promoter for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m1 promoter
UseCRISPRExpressionPlantPromoterMtU6.6m1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-29
Plasmid#246312PurposeEvaluation of PtU6.2 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.2 promoter
UseCRISPRExpressionPlantPromoterPtU6.2 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJK384.4
Plasmid#155369PurposedCas9 + PA4-mVenusDepositorInsertsdCas9 (bacteria)
PA4-mVenus
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)AvailabilityAcademic Institutions and Nonprofits only -
pSG1016-2xBsaI-SaKKH_P2A_EGFP
Plasmid#239461PurposeCodon-optimized S. aureus KKH Cas9. 2x BsaI sites for easy cloning of varying deaminases. EGFP can serve as a transfection marker.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-ACTB-C4
Plasmid#229846PurposeExpresses wild-type Cas9 and gRNA for ACTB gene.DepositorInsertguide RNA for ACTB gene
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-NT2
Plasmid#229848PurposeExpresses wild-type Cas9 and gRNA with non-target sequence.DepositorInsertguide RNA with non-target sequence
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-DRGFP
Plasmid#113193PurposeDR-GFP substrate (Addgene #26475) flanked by human AAVS1 homology arms. Endogenous AAVS1 promoter drives T2A-hygromycin expression after integration. DR-GFP cassette contains PGK-puromycin.DepositorInsertDR-GFP
UseDonor construct with t2a-hygromycin for gene trap…ExpressionMammalianAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
act5c-LbCas12a
Plasmid#140620PurposeUbiquitous expression of LbCas12a in DrosophilaDepositorInsertLbCas12a
UseCRISPRExpressionInsectAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1259
Plasmid#61251PurposeCas9 plasmid with sgRNA deleted; for use in C. elegansDepositorInsertDeletion
UseCRISPRExpressionWormMutationDeleted sgRNA(F+E) sequence from pJW1219Available SinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
Construct 3 - U6p_20nt1_mod2_sgRNA (stgRNA)
Plasmid#81246PurposeFor assaying self-targeting activity via Cas9DepositorInsertsgRNA
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Construct 1 - U6p_20nt1_WT_sgRNA
Plasmid#81245PurposeFor assaying self-targeting activity via Cas9DepositorInsertsgRNA
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceAug. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
C119
Plasmid#174354PurposeCRISPR-Cas9 with guide targeting human PABPC1 genomic location near STOP codonDepositorInsertgRNA sequence targeting human PABPC1 near stop codon region
UseCRISPRAvailabilityAcademic Institutions and Nonprofits only -
ACE Reporter (pLenti-CMV-mCherry (+43) -T2A-eGFP)
Plasmid#109428PurposeA lentiviral backbone expressing mCherry with a 43 basepair insert and eGFP off of a CMV promoter. A reporter for both Cas9 nuclease and APOBEC-mediated base-editing activity.DepositorInsertmCherry T2A GFP
UseLentiviralMutationInserted 43 base pairs into mCherry to create rep…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only