We narrowed to 25,334 results for: Spr
-
Plasmid#86286PurposeDonor vector for 3' FLAG tag of human KLF9DepositorAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only
-
TetO-FUW-VdC9BV
Plasmid#62195PurposeExpresses RNA-Guided, Nuclease-Inactive VP64:dCas9-BFP:VP64—VdC9BV—Fusion Protein to Enable Transactivation of Endogenous GenesDepositorInsertVP64dCas9BFPVP64
UseLentiviralTagsTwo VP64s tagged to dCas9 fused to BFPExpressionMammalianMutationD10A H840A (catalytically inactive) Cas9 (dCas9)Available SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330_TOMM20 sgRNA / hSpCas9
Plasmid#172836PurposeMammalian expression of a sgRNA targeting the intron 4 (last intron) of TOMM20 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 4 of TOMM20 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.0-Pct5.1-crRNA(AarI)
Plasmid#191633PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(nontargeting spacer), entry plasmid for crRNA cloningDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-PspCas13b-msfGFP-NES-Flag
Plasmid#165071Purposeoverexpression of PspCas13b in human cellsDepositorInsertPspCas13b
UseLentiviralExpressionMammalianAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-H3C2
Plasmid#207780PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of H3C2 for knock-in.DepositorAvailable SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_TFRC_C (with mCherry)
Plasmid#72627PurposeExpresses two gRNAs targeting the TFRC promoterDepositorInsertgRNAs toward TFRC
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-TJP1
Plasmid#227300PurposeDonor template for mStayGold insertion into the N-terminus of the TJP1 locus. For tight junction visualization. To be co-transfected with sgRNA plasmid px330-TJP1 (Addgene #227299)DepositorInsertTJP1 Homology Arms flanking a mStayGold Tag (TJP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCFD5-U6-3-t-attP40
Plasmid#133561PurposegRNA vector for targeting near the attP40 locus, use with pHD-3XP3-dsRed-DattP-CRISPR-donor-attP40 based constructsDepositorInsertattP40 region guide RNAs
UseCRISPRExpressionInsectPromoterU6Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_mic
Plasmid#184916PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_mic recombines in vivo with a PCR product from pEasyG2_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2T-CAG-SpCas9-BlastR
Plasmid#107190PurposeConfers constitutive expression of SpCas9DepositorInsertSpCas9 (NEWENTRY )
UseCRISPRTags3xFLAGExpressionBacterial and MammalianPromoterChicken ß-actinAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJK-caCas9-NatMX-Neut5L-Leu2 drive
Plasmid#89578PurposecaCas9 integrating vector into the Neut5L locus with gene drive for targeting Leu2 locusDepositorInsertLeu2 gene drive
ExpressionYeastAvailable SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_TUBA1B sgRNA / hSpCas9
Plasmid#172834PurposeMammalian expression of a sgRNA targeting the intron 1 of TUBA1B (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of TUBA1B under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-OC-IRES-BSD
Plasmid#53118PurposeTo create stable cell clones with high-level expression of Cas9 and OCT1DepositorInsertsUseLentiviralTagsIRES-BSD, NLS, and P2AExpressionMammalianMutationhuman codon-optimizedPromoterCMVAvailable SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-PguCas13b-msfGFP-NES-Flag
Plasmid#165072Purposeoverexpression of PguCas13b in human cellsDepositorInsertPguCas13b
UseLentiviralExpressionMammalianAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
p207-Switch-ON (FRT)
Plasmid#217886PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-mTagBFP2-2A-Puro_hU6-RfxDR36-BsmBI
Plasmid#226011PurposeCasRx guide RNA cloning backbone (lenti)DepositorTypeEmpty backboneUseLentiviralAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPseq-mCherry-backbone
Plasmid#85708PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with an mCherry fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcU6_1 sgRNA
Plasmid#92395PurposeChicken-specific U6 sgRNA expression mini-vector, harbouring chick U6_1 pol III promoter.DepositorInsertchick U6.1 promoter and gRNA cloning cassette
UseCRISPRExpressionMammalianPromoterchick U6.1Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only