We narrowed to 2,018 results for: cas9 expression vector
-
Plasmid#163463Purposelentiviral vector expressing Cas9 and an sgRNA targeting METAP1DepositorInsertsgRNA 2 targeting METAP1 (METAP1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGE671
Plasmid#153237PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE673
Plasmid#153239PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgHK2_14
Plasmid#239257Purposelentiviral vector expressing Cas9 and an sgRNA targeting HK2DepositorInsertsgRNA_14 targeting HK2 (HK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMTHFD1
Plasmid#217436PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human MTHFD1DepositorInsertsgRNA targeting MTHFD1 (MTHFD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTK2_4
Plasmid#217431PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TK2DepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTK2_5
Plasmid#217432PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TK2DepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgSHMT2
Plasmid#217435PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human SHMT2DepositorInsertsgRNA targeting SHMT2 (SHMT2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_COX4
Plasmid#177983Purposelentiviral vector expressing Cas9 and a sgRNA targeting COX4DepositorInsertsgRNA targeting COX4
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG438
Plasmid#165486PurposeVector for expression of the SpCas9 VRKG variant in human cells: CMV-T7-humanVRKG(SpCas9, D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFLAGDepositorInsertMammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
UseCRISPRTags3x FLAG and SV40 NLSExpressionMammalianMutationD1135V, S1136R, D1332K, and R1333G mutations in S…PromoterCMV and T7Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGE669
Plasmid#153235PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE672
Plasmid#153238PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRa_VPR_yl
Plasmid#107677PurposeCRISPR-dCas9-VPR vector for Yarrowia lipolytica, expressing dCas9-VPR and AvrII site for sgRNA insertionDepositorInsertsCodon optimized dCas9-VPR
sgRNA expression cassette
UseCRISPR and Synthetic BiologyExpressionYeastPromoterSCR1'-tRNA and UAS1B8-TEF(136)Available SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDD143
Plasmid#119880PurposeArabinose inducible dCas9sth1 and constitutive sgRNA on pAL5000/pMB1 backbone with gentamicin resistance.DepositorInsertpBAD_dCas9sth1
ExpressionBacterialAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGH044_mCherry
Plasmid#85412Purposelentiviral expression vector for mCherryDepositorInsertmCherry
UseLentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGH045_EGFP
Plasmid#85411Purposelentiviral expression vector for GFPDepositorInsertEGFP
UseLentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGH311_wtGFP S65T
Plasmid#85408Purposelentiviral expression vector for wtGFP S65TDepositorInsertwtGFP S65T
UseLentiviralExpressionMammalianAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGH312_wtGFP Q80H
Plasmid#85409Purposelentiviral expression vector for wtGFP Q80HDepositorInsertwtGFP Q80H
UseLentiviralExpressionMammalianAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGH314_wtGFP S65T, Q80H
Plasmid#85407Purposelentiviral expression vector for wtGFP S65T-Q80HDepositorInsertwtGFP S65T, Q80H
UseLentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRi_Mxi1_yl
Plasmid#91248PurposeCRISPR-dCas9-Mxi1 vector for Yarrowia lipolytica, expressing dCas9-Mxi1 and AvrII site for sgRNA insertionDepositorInsertsCodon optimized dCas9-Mxi1
sgRNA expression cassette
UseCRISPR and Synthetic BiologyExpressionYeastPromoterSCR1'-tRNA and UAS1B8-TEF(136)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCD185
Plasmid#113317PurposedCas9, MCP-SoxS_R93ADepositorInsertdCas9 and MCP-SoxS_R93A
UseCRISPRExpressionBacterialMutationR93AAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCD175
Plasmid#113316PurposedCas9, MCP-AsiA, rpoD_F563YDepositorInsertdCas9, MCP-T4.AsiA, rpoD_F563Y
UseCRISPRExpressionBacterialMutationF563YAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 KanR foundation lox casette
Plasmid#132388PurposeFoundation cassette containing lox sites for cre-mediated exchange of inducible vectors, confers mammalian G418 resistance, targets AAVS1 locusDepositorInsertG418 resistance
UseCRISPR and Cre/LoxExpressionMammalianPromoterpromoterlessAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-mcherry
Plasmid#202822PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs that delete exon 1 within the ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CDK5RAP2-SVA-BFP
Plasmid#202824PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CDK5RAP2 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within CDK5RAP2 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-SCN8A-SVA-BFP
Plasmid#202826PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the SCN8A gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within SCN8A gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-AK057321-SVA-mcherry
Plasmid#202821PurposeLentiviral vector modified to express two sgRNAs that delete the SVA within the SVA-lncRNA AK057321 gene (exon 3) with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within SVA-lncRNA AK057321 gene
UseLentiviralExpressionMammalianPromoterU6 (two)Available SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CHAF1B-SVA-BFP
Plasmid#202825PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CHAF1B gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within CHAF1B gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only