-
Plasmid#137036Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi HtrA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66500.2 (BB_0104 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMH0006
Plasmid#135448PurposeHuman expression vector containing Ubiquitous Chromatin Opening Element (UCOE) upstream of EF1alpha promoter, dCas9 that is fused to NLS, tagBFP and a KRAB domain.DepositorInsertdCas9-BFP-KRAB
UseLentiviralTagstagBFPExpressionMammalianMutationPromoterEF1AAvailable sinceJuly 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMuLE_EXPR_CMV-eGFP_TOP-NLuc1.1_12GLI-FLuc_CBF-GLuc
Plasmid#113862PurposeTriple pathway reporter, 3P-Luc; wnt-NLuc1.1, hedgehog-FLuc, notch-GLuc; plus CMV-eGFP. Gateway expression vector for lentivirus generation.DepositorInsertsCMV-eGFP
TOP-NLuc1.1
12GLI-Fluc
CBF-GLuc
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorA(sp)-mNeonGreen
Plasmid#205020PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorA signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorA-mNeonGreen
UseTagsExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable sinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDipA-TEV-His12
Plasmid#137042Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi DipA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66790.1 (BB_0418 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
GANES-DEVD-BNLS
Plasmid#50842PurposeExpresses a tandem green ddFP heterodimer in mammalian cells, construct 1 for a green to red colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid RANLS.DepositorInsertddGFP A and ddGFP B
UseTagsNES sequence LALKLAGLDIGS placed after ddGFP A an…ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pELPS-eDHFR-YFP-T2A-Renilla
Plasmid#193253PurposeTriple reporter plasmid in pELPS with eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferaseDepositorInsertThe eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferase
UseLentiviralTagsRenilla luciferase (rLuc) and yellow fluorescent …ExpressionMutationNonePromoterEF1aAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
NESRA-DEVD-BNLS
Plasmid#50849PurposeExpresses a tandem red ddFP heterodimer in mammalian cells, construct 1 for a red to green colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid GANLS.DepositorInsertddRFP A and ddRFP B
UseTagsNES sequence LQKKLEELELDE placed after ddGFP A an…ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCyCEN_Lisp2mCherry_hsp70_GFP
Plasmid#137169PurposeDual fluorescent reporter for liver stage expression in Plasmodium cynomolgiDepositorInsertsmCherry
Nanoluc
dihydrofolate reductase
Green Fluorescent Protein
UseUnspecifiedTagsT2AExpressionMutationPromoterP. cynomolgi hsp70 and P. cynomolgi lisp2Available sinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
RANLS-DEVD-BNES
Plasmid#50840PurposeExpresses a tandem ddFP heterodimer in mammalian cells, plasmid 1 for a translocation-based red fluorescent caspase-3 biosensor, used together with plasmid 2 (BNLS).DepositorInsertddRFP A and ddRFP B
UseTagsNES sequence LALKLAGLDIGS and triplicated NLS seq…ExpressionMammalianMutationPromoterCMVAvailable sinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBBA57-TEV-His12
Plasmid#137033Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BBA57 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66270.1 (BB_A57 Borrelia burgdorferi B31)
UseTagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length BBA57, contains signal pep…PromoterT7Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/mEGFP-1T-IRES-mCherry
Plasmid#190190PurposeLentiviral expression vector with altered Kozak sequence to direct EGFP expression. mCherry expression is regulated by an IRES.DepositorInsertsmEGFP
mCherry
UseLentiviralTagsExpressionMutationchanged EGFP Kozak sequence inserting a C>T mo…PromoterEIF1-shortAvailable sinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorT(sp)-mNeonGreen
Plasmid#205021PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorT signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorT-mNeonGreen
UseTagsExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable sinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSET-XS-VWF
Plasmid#64847PurposeExpresses aa1594–1670 of VWF A2 domain flanked by Venus and Cerulean and tagged with 7X His at C terminusDepositorInsertVenus_VWF A2 domain aa 1594-1670_Cerulean_TEV_7X His (VWF Human, Synthetic)
UseTags7X His, Cerulean, and VenusExpressionBacterialMutationPromoterT7Available sinceMay 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-Farnesyl-5
Plasmid#55481PurposeLocalization: Plasma Membrane, Excitation: 462, Emission: 492DepositorInsertFarnesyl (HRAS Human)
UseTagsmTFP1ExpressionMammalianMutationencodes final 20 aa of NM_001130442.1PromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-MAPTau-N-10
Plasmid#55498PurposeLocalization: Microtubules, Excitation: 462, Emission: 492DepositorInsertMAPTau (MAPT Human)
UseTagsmTFP1ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP4A 153-222
Plasmid#108256PurposeExpresses C-terminal 153-222 residues of CHMP4A with non-native N-term cysteine for fluorescent labeling; Internal ID: WISP18-6DepositorInsertCHMP4A residues 153-222 (CHMP4A Human)
UseTagsHis-SUMOExpressionBacterialMutationContains nonnative Gly-Cys for fluorescent labeli…PromoterT7Available sinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCapVQ329R
Plasmid#183029Purposethe patatin-like phosphodiesterase CapV variant CapVQ329R cloned in the L-arabinose inducible vector pBAD28DepositorInsertpatatin-like phospholipase variant CapVQ329R
UseTagsNoExpressionBacterialMutationglutamine 329 changed to argininePromoterpBAD promoterAvailable sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB120
Plasmid#167150PurposeMoClo-compatible Level 1 (position 1) vector encoding Kanamycin resistance cassette, for expression in plantsDepositorInsertpNOS-nptII-ocsT
UseTagsExpressionPlantMutationPromoterpNOSAvailable sinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only