We narrowed to 122,990 results for: CIL
-
Plasmid#91569PurposeMariner transposon mutagenesis & sequencing vector - Transposon contains KanR and Illumina sequencing adapters. Arabinose promoter expresses transposase. Ampicillin resistance on backbone.DepositorInsertAraC/PBAD
ExpressionBacterialAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM60 FLAG-RAB35 S22N
Plasmid#107106PurposeLentiviral vector that codes for FLAG-RAB35 S22N (human) protein. Puromycin resistance for mammalian selection and ampicillin resistance for growth in Stbl3 cells.DepositorAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJM60 FLAG-RAB35 wt
Plasmid#107104PurposeLentiviral vector that codes for FLAG-RAB35 wildtype (human) protein. Puromycin resistance for mammalian selection and ampicillin resistance for growth in Stbl3 cells.DepositorInsertRAB35 (RAB35 Human)
UseLentiviralTagsFLAG tagExpressionMammalianMutationwildtypePromoterCMVAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-INPP5E
Plasmid#223564PurposeExpresses the full-length mouse INPP5E (Pharbin)DepositorAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pS148∙CsR
Plasmid#197858PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Ap/Cb resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ292 (AaCas12b)-D570A-TV-MS2-VPR
Plasmid#136382PurposeCRISPRa Gateway entry clone for catalytically dead AaCas12b (D570A) fused with TV activation system, followed by T2A and MCP-VPR fusion proteinDepositorInsertAaCas12b (D570A)-TV-T2A-MCP-VPR
UseCRISPRExpressionPlantMutationD570AAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-scFv-T
Plasmid#67843PurposepET-30-based vector dedicated to efficient scFv expression, which circumvents the problem of in-frame amber codons in scFvs.DepositorInsertantibody 1D8 light kappa chain
TagsHis-tagExpressionBacterialPromoterT7 promoterAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
p221a-GUS
Plasmid#71263PurposeEntry clone containing the GUS enzyme. Can be used to construct transcriptional reporters. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGatewayAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
YEE-BE4max
Plasmid#138157PurposeC-to-T base editorDepositorInsertrAPOBEC1(YEE)-nSpCas9-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R126E + R132E; within Cas9…PromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRARE-MBP-DEST
Plasmid#84650PurposeGateway cloning vector expresses MBP-tagged proteins under the control of the IPTG– inducible ptac promoter and also expresses several tRNAs that are rare in E. coli.DepositorTypeEmpty backboneTagsMBPExpressionBacterialPromotertacAvailable SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNG1256
Plasmid#149710PurposeExpresses RpoA, RpoB, RpoC-9His and RpoZ from Bacillus subtilis to produce core RNAP complexDepositorAvailable SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCM’
Plasmid#162709PurposepCCM reconstructed after selection for CCMB1 growth on glycerol under ambient airDepositorInsertSecond CCM operon cloned from H. neapolitanus
ExpressionBacterialMutationp15A origin replaced with high-copy colE1 originPromoterPLtet0-1 promoterAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Ahi1
Plasmid#30494DepositorAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC3-hGli3
Plasmid#65435PurposeExpresses human Gli3 protein in mammalian cellsDepositorAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AALN-BE4max
Plasmid#138161PurposeC-to-T base editorDepositorInsertrAPOBEC1(AALN)-nSpCas9-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 R33A + K34A + H122L + D124N; with…PromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-N-HA-Pcdh15_mini_V4
Plasmid#199185PurposeAn AAV plasmid designed to facilitate the expression of mini-PCDH15 in the inner ear of a mouse.DepositorInsertHA-mmPcdh15_mini_V4-CD2
UseAAVTagsHuman influenza hemagglutinin (HA)Available SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MDV1A
Plasmid#196679PurposeRep/Cap plasmid for the production of MDV1A, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRSVGSVY insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMy-MouseCTCFbiotag-T2A-mOrange
Plasmid#50564PurposeRetroviral vector endoding for mOrange and mouse CTCF with a short biotinylation substrate (biotag, Kimetal.,2009) fused to its C-termDepositorInsertsAmpicilin
Mouse CTCF Exons
UseRetroviralAvailable SinceFeb. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28:LanIII-43
Plasmid#225077PurposeExpresses precursor peptide and lanthipeptide synthetase from LanIII-43 (FAST-RiPPs) in E. coliDepositorInsertLanA (LanIII-43)
TagsHis6ExpressionBacterialMutationWTPromoterT7Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PLXNB2
Plasmid#86236PurposePLXNB2 full-length human cDNA CDS in gateway entry plasmidDepositorInsertPLXNB2 (PLXNB2 Human)
UseGateway entry vectorAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3R112C/T180CBM3
Plasmid#85090PurposeExpresses PCNA3 variant (R112C/T180C) fused to P450 BM3 variant (A74G/C773S/C810S) in E. coliDepositorInsertThe R112C/T180C variant of PCNA3 fused to P450 BM3
TagsHis6 tagExpressionBacterialMutationR112C/T180C in PCNA3, A74G/C773S/C810S in P450BM3PromoterT7 promoterAvailable SinceDec. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFNC-3
Plasmid#233296PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. CmR, easily curable via sucrose counterselection.DepositorInsertsBxbI phage integrase
sacB
ExpressionBacterialPromoterPEM7 and unknownAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEMI91
Plasmid#74888PurposeShuffled 9I27 polyprotein with shuffled codons to allow facile sequencing and unique RE for the 9 cassettes for versatile cloning. See Depositor Comments for more informationDepositorInsertTitin I27 x 9 (TTN Human)
TagsHis-tag and Strep-tag IIExpressionBacterialPromoterT7 promoterAvailable SinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
YE1-BE4max-CP1028
Plasmid#138160PurposeC-to-T base editorDepositorInsertrAPOBEC1(YE1)-nSpCas9 (CP1028) -UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R126E; within Cas9 (CP1028…PromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
5HT6-YFP-ThymosinBeta4(KK18,19EE)
Plasmid#96807Purposenon-actin-binding control for 5HT6-YFP-ThymosinBeta4(WT)DepositorInsert5HT6-YFP-ThymosinBeta4 (Tmsb4x Mouse)
TagsYFPExpressionMammalianMutationKK18,19EE prevents G-actin bindingAvailable SinceSept. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
GB1-ALIX(P801G)
Plasmid#180025PurposeCodon-optimized bacterial expression plasmid. Expresses GB1-His6-TEV-ALIX(1-868, P801G). P801G mutation facilitates expression in E. coli.DepositorInsertGB1-His6-TEV-ALIX(1-868, P801G) (PDCD6IP Human)
TagsGB1-His6-TEVExpressionBacterialMutationP801GAvailable SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCCM
Plasmid#162708PurposeSecond CCM operon cloned from H. neapolitanus; pFA expressing the remaining 11 genes in the H. neapolitanus CCM clusterDepositorInsertSecond CCM operon cloned from H. neapolitanus
ExpressionBacterialPromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRGEB-Cas9-VirD2 (PCO)
Plasmid#139802PurposeExpressing Cas9-VirD fusion under ubiquitin promoterDepositorInsertCas9-VirD2
TagsCas9-VirD2ExpressionPlantPromoterUbiquitinAvailable SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1C
Plasmid#196685PurposeRep/Cap plasmid for the production of PAL1C, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTLR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
VanGlow-GL
Plasmid#83342Purposefor Gateway cloning of promoter elements upstream of a GFP::Luciferase(nls) reporter, facilitating qualitative and quantitative analysis of expression in transgenic fly lines and S2 cells.DepositorTypeEmpty backboneUseLuciferaseTagsGFP::Luciferase(nls)ExpressionInsectAvailable SinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
DCT.VV.Orf45
Plasmid#12733PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf45
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1deltaH4/2H5
Plasmid#71715PurposeMembrane scaffold protein (MSP), helix 4/2 + helix5 deletionDepositorAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRGEB-VirD2-Cas9
Plasmid#139803PurposeExpressing VirD-Cas9 fusion under ubiquitin promoterDepositorInsertVirD2-Cas9
TagsVirD2-Cas9ExpressionPlantPromoterUbiquitinAvailable SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
VanGlow-RR
Plasmid#83343Purposefor Gateway cloning of promoter elements upstream of a mCherry::Renilla(nls) reporter, facilitating qualitative and quantitative analysis of expression in transgenic fly lines and S2 cells.DepositorTypeEmpty backboneUseLuciferaseTagsmCherry::Renilla(nls)ExpressionInsectAvailable SinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIN4_tsp-6_mScarlet
Plasmid#182935PurposeExpresses tsp-6::mScarlet under its native promoter (amphid and phasmid ciliated neurons in C. elegans)DepositorInsertPtsp-6-3::tsp-6::flexible linker::mScarlet (C. elegans, genomic)
Tagsflexible linker (GGGGS)x3 and mScarlet tagExpressionWormPromotertsp-6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-p73DD L371P-pcDNA3
Plasmid#23049DepositorInserttumor protein p73 (TP73 Human)
TagsT7ExpressionMammalianMutationtruncated cDNA encodes truncated protein (aa 327-…Available SinceJan. 28, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1deltaH4/2
Plasmid#71712PurposeMembrane scaffold protein (MSP), half of helix 4 truncatedDepositorAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX-GP-2-DNMT3A PWWP
Plasmid#59696PurposeContains histone modification interacting domain (DNMT3A PWWP)DepositorAvailable SinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX-GP-2-CBX7 Chromo
Plasmid#59695PurposeContains histone modification interacting domain (CBX7 Chromo)DepositorAvailable SinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONRG_P4-P1R:MUM4_0.3Pro_35S
Plasmid#128558PurposeGateway (Invitrogen) promoter clone (pDONRG_P4-P1R) containing a 307 bp MUM4 (At1g53500) promoter fragment fused to the 54 bp 35S minimal promoter sequence, for use in Three-way Gateway cloningDepositorTypeEmpty backboneUseGateway promoter entry clonePromoterMUM4 core promoter with 35S enhancerAvailable SinceSept. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYPQ292 (AaCas12b)-D570A-TV-MS2-TV
Plasmid#136381PurposeCRISPRa Gateway entry clone for catalytically dead AaCas12b (D570A) fused with TV activation system, followed by T2A and MCP-TV fusion proteinDepositorInsertAaCas12b (D570A)-TV-T2A-MCP-TV
UseCRISPRExpressionPlantMutationD570AAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU-eCFP
Plasmid#176557PurposeExpression of eCFP for auxotrophic selection in the absence of uracilDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU-mRuby2
Plasmid#176549PurposeExpression of mRuby2 for auxotrophic selection in the absence of uracilDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDsRed2-C1-Ahi1
Plasmid#30495DepositorAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC1-Intu
Plasmid#65430PurposeFor mammalian expression of EGFP-mouse InturnedDepositorAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Mus.1
Plasmid#196681PurposeRep/Cap plasmid for the production of M.Mus.1, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationWVLPSGG insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MDV1B
Plasmid#196680PurposeRep/Cap plasmid for the production of MDV1B, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationKTVGTVY insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB401+Citrine
Plasmid#128432PurposeModified R4pGWB401 three way Gateway destination vector (Nakagawa et al. 2008) that enables C-terminal fusion of Citrine, a dimeric acid stable yellow fluorescent protein.DepositorTypeEmpty backboneUseGateway destination vectorTagsCitrine, yellow fluorescence proteinExpressionPlantAvailable SinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only