We narrowed to 6,626 results for: GFP expression plasmids
-
Plasmid#135766PurposeThis plasmid can be used to express independently eGFP and a zebrafish wt1b dominant negative isoform (N-terminal domain) from a bidirectional 5xUAS. Also CFP expression under crystallin promoter.DepositorAvailable SinceJan. 29, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pET28a-HIS-TagGFP2-TEV-GGG-ELP(40nm)-Cys
Plasmid#90474PurposeElastin Like Polypeptide: [(VPGEG)-(VPGVG)4-(VPGAG)2-(VPGGG)2-(VPGEG)]2, with N-Terminal TagGFP2 and TEV-cleavage site, leaving an N-terminal Sortase Recognition Sequence GGG and a C-terminal CysteineDepositorInsertTagGFP2-TEV-GGG-ELP(40nm)-Cys
TagsCysteine and Sortase-TagExpressionBacterialPromoterT7Available SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRS305-mAID-LaM4
Plasmid#198414PurposeExpress mAID-Nb(LaM4) under the control of ADH1 promoter in budding yeastDepositorInsertmAID-Nb (LaM4)
ExpressionYeastPromoterADH1 promoterAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP1 POD-nAb-WPRE
Plasmid#244973PurposeExpresses a fusion protein of a nanobody against GFP and peroxidase (POD) in mammalian cellsDepositorInsertGFP1 POD-nAb
Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-WT-P2A-EGFP (BKS953)
Plasmid#242651PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpCas9-P2A-EGFP
UseCRISPRExpressionMammalianMutationABE8.8 mutations in TadAPromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-cOpn5-T2A-EGFP
Plasmid#237859PurposeThe transfer plasmid for packaging AAV expressing chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of GfaABC1D promoterDepositorAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mCherry-P2AT2A-EGFP-BRD4-NUT
Plasmid#238281PurposeFor overexpression of mCherry-P2AT2A-EGFP-BRD4-NUTDepositorInsertmCherry-P2AT2A-EGFP-BRD4-NUT
ExpressionMammalianAvailable SinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-anti-GFP(LaG16) PAGER(Gi)
Plasmid#230008PurposeExpresses anti-GFP PAGER(Gi) in mammalian cellsDepositorInsertMT1-LaG16-TEVcs-ALFA-hM4D
UseAAVExpressionMammalianPromoterCMVAvailable SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP-P2A-FusionRed
Plasmid#191108PurposeMammalian cell line expression plasmids for production of EGFP and FusionRed proteinsDepositorInsertpAAV-CAG-EGFP-P2A-FusionRed
UseAAVTagsFusionRedExpressionMammalianMutationSee depositor comments belowPromoterchicken β-actin promoterAvailable SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
mCh-LgBiT-2A-EGFP-Vin-PILATeS
Plasmid#216761PurposePiggyBac vector for stable co-expression of mCherry-LgBiT and EGFP-Vinculin-PILATeS (700 pM) in mammalian cells. Requires transposaseDepositorInsertmCherry-LgBiT-P2A-T2A-EGFP-Vin-PILATeS
TagsEGFP and mCherryExpressionMammalianAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 MMP2 g1
Plasmid#170824PurposePiggyBac Cas13d sgRNA plasmid for MMP2 knockdownDepositorInsertCas13d MMP2 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 CLCN3 g2
Plasmid#170829PurposePiggyBac Cas13d sgRNA plasmid for CLCN3 knockdownDepositorInsertCas13d CLCN3 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOCC120-MBP-DDX3X-monoGFP-His
Plasmid#219985PurposeDDX3X(WT) protein purificationDepositorAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
BS-TRP1-TetOff(7repeats)-GFP-Pho8
Plasmid#207011PurposeTet-Off controlled GFP-Pho8 with TRP1 selection. Tetracycline-controlled transactivator (tTA) present on same plasmid.DepositorInsertPho8
TagsGFPExpressionYeastAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
px552-U6-gRNA1-U6-gRNA2-CMV-eGFP
Plasmid#211760PurposePaired gRNAs (sgRNA1 and 2) targeting Exon 1 of VEGFA gene conserved across mouse, rhesus macaque, and human.DepositorInsertgRNA1 and gRNA2 targeting VEGF-A (VEGFA Mouse, Human, M. mulatta (rhesus macaque))
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTOR-F2108L_CD19-CAR-28z-2A-EGFP_AAV6_Donor
Plasmid#211904PurposeVector for AAV6 donor production. Targeted CD19-CAR-28z-2A-EGFP transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.DepositorInsertCD19-CAR-28z-2A-EGFP
UseAAVExpressionMammalianPromoterhPGK1Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-mCD59-T2A-GFP
Plasmid#205451Purposelentiviral plasmid for expression of mouse CD59DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-AcGFP-P2A-hBRD4S
Plasmid#197882Purposestudy roles of human BET proteins in human pluripotency reprogrammingDepositorAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-IgM-IRES-GFP
Plasmid#187011PurposeExpression of human anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgMDepositorInsertHuman anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgM
UseLentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-IgA1-IRES-GFP
Plasmid#187007PurposeExpression of human anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgA1DepositorInsertHuman anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgA1
UseLentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-H2B-sfGFP-T2A-iCre
Plasmid#183351PurposeHistone H2B-sfGFP and iCre recombinaseDepositorInsertHistone H2B-sfGFP-T2A-iCre
UseCre/LoxExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET29b-eGFP-dspB(E184Q)-6xHis
Plasmid#175783PurposePlasmid for overexpression of recombinant His-tagged fusion protein eGFP-DspB(E184Q), used as a fluorescent probe for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsHexahistidine tag and eGFPExpressionBacterialMutationE184QPromoterT7Available SinceDec. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-1.03kb-EGFP
Plasmid#153164PurposeTruncated mouse gamma-synuclein (mSncg-1.03kb) promoter-mediates gene expression in mammalian retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.66kb-EGFP
Plasmid#153165PurposeTruncated mouse gamma-synuclein (mSncg-0.66kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
KZ901: pMVP (L3-L2) P2A-eGFP + WPRE
Plasmid#121772PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eGFP + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Archon1-KGC-EGFP
Plasmid#108418PurposeAAV production plasmid encoding for Archon1 fluorescent voltage reporterDepositorInsertArchon1-KGC-EGFP
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBac[3xP3-gTc'v;Tc'puP-Tc'H2Av_EGFP]
Plasmid#86455PurposeNuclear reporter (histone-tagged EGFP) construct with Tribolium specific polyubiquitin promoter (driving ubiquitous expression); (Transformation plasmid; Black eye marker)DepositorInsert3xP3-gTc'v;Tc'puP-Tc'H2Av_EGFP
ExpressionInsectAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-TACC3KDP(L566,567A)-shTACC3
Plasmid#69117PurposeDual-promoter plasmid to express knockdown-proof human TACC3 (L566A and L567A substitutions) tagged with EGFP along with shRNA to knock down endogenous TACC3 in mammalian cells.DepositorInsertsUseRNAiTagsEGFPExpressionMammalianMutationLL (566-567aa) mutated to AA. Silent mutations i…PromoterCMVAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pES005 (pTet-qacR wt/pQacA-deGFP)
Plasmid#69034Purposereporter with wild-type qacR on single plasmidDepositorAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Dnmt3b1-Poly(A)-NeoR
Plasmid#65551PurposePlasmid for Bxb1-mediated recombination of the GFP-Dnmt3b1 cDNA into a MIN-tagged locus using Neomycin selectionDepositorInsertDnmt3b (Dnmt3b Mouse)
UseMouse Targeting; Bxb1TagsGFPExpressionMammalianMutationisoform 1Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Tet1d834-1363-Poly(A)
Plasmid#65560PurposePlasmid for Bxb1-mediated recombination of the GFP-Tet1d1054-1363 cDNA into a MIN-tagged locusDepositorInsertTet1 (Tet1 Mouse)
UseMouse Targeting; Bxb1TagsGFPExpressionMammalianMutationdel(834-1363)Available SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpG-P2A-EGFP (BKS777/AHK571)
Plasmid#223124PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpG with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpG-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpG=D10A/D1135L/S1136W/G1218…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE pGK LC3Flux (HaloTag7-mGFP-LC3-STOP)
Plasmid#215015PurposeExpress an autophagy (LC3) reporter in mammalian cells (untested)DepositorAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-DIO-Rpl22l1-3Flag-2A-eGFP-WPRE
Plasmid#214265PurposeExpression of a Flag-tagged Rpl22I1 protein in cells expressing Cre recombinase allowing for the harvesting of actively transcribed mRNAs in that cell type.DepositorInsertFlag-tagged Rpl22I1 protein expressing Cre Recombinase (Rpl22 Mouse)
UseAAVTagsEGFPExpressionMammalianMutationN/APromoterSynapsinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRCH-P2A-EGFP (RMD55)
Plasmid#197501PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRCH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRCH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRCH(D10A/I…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-MCS-P2A-EGFP
Plasmid#176276PurposeViral vector for co-expression of a CDS of interest and EGFP in cells expressing Cre AND NOT Flp driven by a Synapsin promoter. Contains an in-frame P2A sequence and an MCS for cloning of the CDS.DepositorInsertMCS-P2A-EGFP
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLENTI CMV GFP TREX1 R128A R174A BLAST
Plasmid#164234Purposelentiviral plasmid for GFP-TREX1 R128A R174ADepositorInsertTREX1 (TREX1 Human)
UseLentiviralTagsGFPExpressionMammalianMutationR124A R174APromoterCMVAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HA-dnGFP-OGT(13)
Plasmid#247677PurposeExpresses full-length OGT fused to a destabilized GFP nanobodyDepositorAvailable SinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EGFP-HOTag3
Plasmid#225677PurposeUsed to generate stable cell lines that express EGFP-HOTag3. This plasmid serves as a control for pLVX-PERK(LD)-EGFP-HOTag3.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
PAX3::FOXO1ΔHD-2A-sfGFP
Plasmid#240099Purposehuman PAX3::FOXO1 with homeobox domain deletion in -2A-sfGFP backbone (Plasmid# 240099)DepositorExpressionMammalianMutationremoved amino acids 218-278 for the homeobox DNA …Available SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP Rab3a T36N
Plasmid#245014PurposeDistribution and localization of rat Rab3a T36N mutantDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP Rab27a Q78L
Plasmid#245024Purposehuman Rab27a Q78L mutantDepositorAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
13xLexAop2 IVS sfGFP1-10
Plasmid#221834PurposePlasmid for generating 13xLexAop2 IVS sfGFP1-10 with attP/attB integration. It carries the attB sequence.DepositorInsertsfGFP1-10
ExpressionInsectPromoterhsp70Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWal10-roe-sfGFP
Plasmid#240239PurposeGateway destination plasmid to generate C-terminal sfGFP fusions under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorTypeEmpty backboneUseGateway CloningExpressionInsectAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV-d2eGFP-pA
Plasmid#233048PurposeTo express D2eGFP from a CMV promoterDepositorInsertD2GFP
UseAAVAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_VHH05-EGFP-NPM1
Plasmid#238268PurposeFor overexpression of VHH05-EGFP-NPM1DepositorInsertVHH05-EGFP-NPM1
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-CRTC1-MAML2-KS
Plasmid#237672PurposeFor overexpression of mEGFP-CRTC1-MAML2-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-TAZ-CAMTA1-KS
Plasmid#237677PurposeFor overexpression of mEGFP-TAZ-CAMTA1-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-EWS-FLI1-KS
Plasmid#237671PurposeFor overexpression of mEGFP-EWS-FLI1-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only