We narrowed to 4,851 results for: u6
-
Plasmid#201960PurposeEBNA episome plasmid for U6 promoter-driven expression of 7 gRNAs targeting miRNA302/367. Includes PGK-puro selection cassetteDepositorInsertMIR302-7g-PGK-Puro
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFE-Puro
Plasmid#170069PurposeExpresses S. pyogenes CRISPR chimeric RNA element (with F+E modifications) with customizable gRNA from U6 promoter and puromycin resistance from EFS-NS promoterDepositorInsertCas9 guide RNA scaffold with the F+E scaffold modification
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 1
Plasmid#51760PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10873
Plasmid#183961PurposeU6-SKSKSO(crRNA array)-CAG-hyperdCas12a-HA-miniVPRDepositorInsertsHyperdCas12a
poly-crRNA array targeting Sox2-Klf4-Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCKO
Plasmid#73311PurposeLentiviral backbone for cloning and expressing U6 driven sgRNAs with BfuAI cloning sites and puromycin selection.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHEE2E-TRI
Plasmid#71288PurposeEgg cell-specific promoter-controlled expression 3×FLAG-NLS-zCas9-NLS and two sgRNAs targeting three genes: ETC2, TRY, and CPCDepositorInsertssgRNA targeting TRY and CPC genes
sgRNA targeting ETC2 gene
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR_219
Plasmid#164559PurposeLentiviral vector that encodes two sgRNA expression cassettes. Also encodes the fluorophore violet-excited GFP (Vex) as a marker of transduction.DepositorInsertsFirst sgRNA cassette
Second sgRNA cassette
UseCRISPR and Lentiviral; Dual sgrnaTagsExpressionMammalianMutationPromoterHuman U6 and Mouse U6Available sinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_2
Plasmid#155078PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionTagsExpressionMutationPromoterArabidopsis U6 polymerase III promoterAvailable sinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
CMV-RfxCas13d-SV40pA_U6-BbsI-DR_CMV-mCherry-BGHpA
Plasmid#171380PurposeExpression vector for encoding a human codon-optimized RfxCas13d driven by CMV promoter,mCherry driven by CMV promoter and U6-driven crRNAs cloning site.DepositorInserthumanized RfxCas13d
UseTagsHAExpressionMammalianMutationPromoterCMV, U6Available sinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 2
Plasmid#51761PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA
Plasmid#86613PurposeVector for tandem expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainTagsExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-CUG
Plasmid#104183PurposeLentiviral transfer vector that carries U6-driven sgRNA targeting CUG repeats using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-CUGsgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainTagsExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV p2GM AMPK alpha2hp1 alpha1hp1
Plasmid#89492PurposeshRNA against AMPK alpha2 and alpha1 in mouse/human to knock down protein expressionDepositorInsert2 hairpins against mouse/human AMPKalpha1 and alpha2
UseRetroviralTagsExpressionMammalianMutationPromoterU6 (The GFP-Puro is from a PGK promoter; the shRN…Available sinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 4
Plasmid#51763PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 4
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 5
Plasmid#51764PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 5
UseCRISPR and LentiviralTagsExpressionMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC178: pAAV.U6.SapI.CMV.Cas13bt3
Plasmid#204215PurposePlasmid AAV vector expressing Cas13bt3 and hU6-driven expression of guide RNAs. Contains SapI sites for guide cloning flanked by 5' and 3' full-length DRs.DepositorInsertCas13bt3 and U6.SapI sgRNA cloning site
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationCodon optimisation by GenScript toolPromoterCMV/U6Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only