We narrowed to 7,495 results for: PAC
-
Plasmid#68837PurposeAdeno-associated Viral Vector (AAV) capsid Anc80L65 in AAV2Rep expression construct. Note that an improved version is available: Addgene plasmid# 92307. See comments for detailsDepositorInsertAncestral AAV Capsid Anc80L65
UseAAV and Synthetic BiologyTagsExpressionMammalianMutationPromoterRep2Available sinceNov. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shp38
Plasmid#52920Purposeexpresses a hairpin specific for human p38MAPKDepositorInsertshRNA targeting mitogen-activated protein kinase p38 (MAPK14 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceMay 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
p1.2-Hyg-Fur
Plasmid#162774PurposeSoluble human PACE/furin protease expressionDepositorInsertHuman PACE/furin protease soluble (FURIN Human)
UseTagsExpressionMammalianMutationPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available sinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAH-CTX1-rhadCas9
Plasmid#129391PurposeDerived from pAH-CTX1-rha. The Burkholderia cenocepacia codon-optimized dCas9 cloned downstream of PrhaBAD. Hence, dCas9 is controlled by the rhamnose-inducible promoter system.DepositorInsertBurkholderia cenocepacia codon-optimized dCas9
UseCRISPRTagsExpressionBacterialMutationEntire dCas9 codon optimized for the GC-rich B. c…PromoterPrhaBADAvailable sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-Ef1a-RPS27A-UTR-PP7-WPRE
Plasmid#198339PurposePB plasmid expressing RPS27A with its 3'UTR tagged to PP7 stem loopsDepositorInsertRPS27A-3'UTR-PP7 stem loops x24
UsePiggybacTagsPP7 stem loopsExpressionMammalianMutationPromoterEf1aAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVU-coHPDL WT
Plasmid#174128PurposeExpresses wild type codon-optimized HPDL in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTagsGFPExpressionMammalianMutationCodon optimizedPromoterAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-C1-FKBP-CYB5tail
Plasmid#202686Purposerapamycin-induced recruitment of proteins to ERDepositorInsertEGFP:FKBP:[GGSA]4GG:CYB5A(100-134) (CYB5A Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-Ef1a-SunTag-RPS7-PP7-WPRE
Plasmid#198338PurposePB plasmid expressing RPS7 mRNA tagged with SunTag repeats and PP7 stem loopsDepositorInsertGCN4x24-RPS7-3'UTR-PP7 stem loops x24
UsePiggybacTagsPP7 stem loops and SunTagExpressionMammalianMutationPromoterEf1aAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL WT 3xFlag-V5
Plasmid#174129PurposeExpresses codon-optimized HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimizedPromoterAvailable sinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas-mut4/1_2_VB
Plasmid#186444PurposeEncodes Cas4(K81A)/1, Cas2, leader, repeat and one spacer from A. acidoterrestris (type V-B)DepositorInsertCas4/1 and Cas2
UseCRISPRTagsExpressionMutationCas4 domain (K81A)PromoterT7Available sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(103)-GFP
Plasmid#197890PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(553)-GFP
Plasmid#197888PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(285)-GFP
Plasmid#197889PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGG198
Plasmid#165605PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with two hEGFP protospacers: PS1(upstream of promoter with 'CAGCG' PAM)-lac-PS2(downstream with 'CGGCG' PAM)-HIS3 and GFPDepositorInserthEGFP protospacer ('CGGCG' PAM) downstream of the HIS3/GFP promoter
UseSynthetic BiologyTagsExpressionBacterialMutationSecondary protospacer ('CGGCG' PAM) ins…PromoterlacAvailable sinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1
Plasmid#218796PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-3
Plasmid#218798PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-3
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI30
Plasmid#183749PurposeAAV-BI30 Rep-Cap plasmid for production of AAV-BI30, a capsid with tropism for CNS endothelial cells.DepositorInsertAAV9 modified with 7mer insertion between amino acids 588 and 589 of VP1
UseAAVTagsExpressionMutationK449R, and NNSTRGG inserted between 588 and 589 o…Promoterp41Available sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA GNSTM-3-RVG-10-Lamp2b-HA
Plasmid#71294PurposeEncodes (N to C): GNSTM glycosylation motif, 3 residue spacer, RVG peptide, 10 residue spacer, Lamp2b (exosomal transmembrane protein), 3 residue spacer, HA tag.DepositorInsertLamp2b (LAMP2 Human)
UseTagsGNSTM glycosylation motif, HA, Lamp2 signal pepti…ExpressionMammalianMutationPromoterCMVAvailable sinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-2NLS-Cas9-6XMS2
Plasmid#166033PurposeExpression of 6X MS2 stem loops fused SpCas9 mRNA for packaging of SpCas9 mRNA within lentiviral particles.DepositorInsertSpCas9
UseCRISPR and LentiviralTagsExpressionMutationPromoterCMVAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATG9A-mCherry
Plasmid#197393PurposeExpresses ATG9A in mammalian cellsDepositorInsertATG9A (ATG9A Human)
UseTagsmChExpressionMammalianMutationPromoterAvailable sinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS hygro
Plasmid#158634PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS constructDepositorInsertMAVS (MAVS Human)
UseLentiviralTags3XFLAGExpressionMutationPromoterAvailable sinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-2
Plasmid#218797PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-2
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBZCas13b
Plasmid#89898PurposeBacterial expression for bzCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
UseTagsExpressionBacterialMutationPromoterLacAvailable sinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPbcas13b
Plasmid#89906PurposeBacterial expression for pbCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
UseTagsExpressionBacterialMutationPromoterLacAvailable sinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS
Plasmid#158628PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVSDepositorInsertMAVS (MAVS Human)
UseGateway entry vectorTags3XFLAGExpressionMutationPromoterAvailable sinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-4
Plasmid#218799PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-4
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT310 AAV-BFPdonor
Plasmid#202057PurposeAAV HDR donorDepositorInsertAAV-BFPdonor
UseAAV; Aav packaging plasmidTagsExpressionMammalianMutationITR deletionPromoterAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas_4(I-U)/1_2_VB
Plasmid#186445PurposeEncodes Cas4/1, Cas2, leader, repeat and one spacer from A. acidoterrestris (type V-B). Cas4 domain swapped with type U-I Cas4 domain from G. sulfurreducensDepositorInsertCas4/1 and Cas2
UseCRISPRTagsExpressionMutationCas4 domain swapped with Cas4 domain from G. sulf…PromoterT7Available sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS10-riboE-dddAI
Plasmid#186561PurposeRegulated expression of the DddA immunity determinant (DddAI) in FirmicutesDepositorInsertdddAI
UseTagsExpressionBacterialMutationPromoterpSpac(hy)Available sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL H163A H258A 3xFLAG-V5
Plasmid#174131PurposeExpresses codon-optimized catalytically inactive HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimized, H163A, H258APromoterAvailable sinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL H258A 3xFlag-V5
Plasmid#174130PurposeExpresses codon-optimized catalytically inactive HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimized, H258APromoterAvailable sinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Gln93
Plasmid#158629PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorInsertMAVS (MAVS Human)
UseGateway entry vectorTags3XFLAGExpressionMutationE93QPromoterAvailable sinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Ala148
Plasmid#158630PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorInsertMAVS (MAVS Human)
UseGateway entry vectorTags3XFLAGExpressionMutationQ148APromoterAvailable sinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA GASTM-3-RVG-10-Lamp2b-HA
Plasmid#71295PurposeEncodes (N to C): GASTM mutated glycosylation motif, 3 residue spacer, RVG peptide,10 residue spacer, Lamp2b (exosomal membrane protein), 3 residue spacer, HA tag.DepositorInsertLamp2b (LAMP2 Human)
UseTagsGASTM mutated glycosylation motif, HA, Lamp2 sig…ExpressionMammalianMutationPromoterCMVAvailable sinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28.His.3C.Tau2N4R
Plasmid#226396PurposeExpresses his-tagged, 3C-cleavable WT 2N4R tau for recombinant protein production in bacteriaDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsHis.3CExpressionBacterialMutationPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SauriABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189925PurposeAAV genome encoding SauriABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSauriABE8e
UseAAVTagsExpressionMutationSauriCas9 D15APromoterEFSAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaKKHABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189923PurposeAAV genome encoding SaKKHABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVTagsExpressionMutationnSaCas9 KKH, TadA ABE8e V106WPromoterEFSAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FKBP12-Gag(HIV)
Plasmid#138476PurposeExpresses FKBP12 fused Gag for packaging FRB-SpCas9 into NanoMEDIC particle.DepositorInsertHIV Gag
UseTagsFRBP12 and Lynn Myristolation siteExpressionMammalianMutationPromoterAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only