-
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYZ165
Plasmid#98418PurposePombe Expression Vector - nmt1 promoter with Sp.his3 markerDepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterAvailable sinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYZ174
Plasmid#98421PurposePombe Expression Vector - nmt1 promoter with Sp.lys9 markerDepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterAvailable sinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
TFORF2509
Plasmid#144387PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertEP300 (EP300 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mScarlet-CAAX2 WPRE
Plasmid#236232PurposeAAV expression of a fluorescent marker, mScarletI, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmScarletI fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmScarletIExpressionMutationPromoterhuman Synapsin 1Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-418_Cacnes_LysA
Plasmid#225607PurposeSuicide C. acnes vector to generate LysA (PPA_RS06345) deletion leaving an Ery resistance cassette flanked by BxbI recombination sitesDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4-T2A-EGFP
Plasmid#228359PurposeRfxCas13d (NLS-RfxCas13d-NLS) with 2A-EGFP and 2A-mCD4 for RNA knockdownDepositorInsertRfxCas13d
UseLentiviralTags2A-EGFP, 2A-mCD4, HA, and NLSExpressionMammalianMutationPromoterEF1AAvailable sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
783-Rx-hU6: RfxCas13d gRNA and array cloning backbone
Plasmid#228360PurposehU6-driven expression of RfxCas13d gRNAs and arrays compatible. Contains AarI sites for guide cloning flanked by 5' DR36DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …TagsExpressionMammalianMutationPromoterhU6Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
783-Rx-Dual: Combinatorial RfxCas13d gRNA and array cloning backbone
Plasmid#228362PurposemU6- and hU6-driven expression of dual RfxCas13d gRNAs and arrays for combinatorial RNA knockdown.DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …TagsExpressionMammalianMutationPromotermU6 and hU6Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CLTC
Plasmid#227314PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold-2A-Puro Cassette (CLTC Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-RAB7A
Plasmid#227298PurposeDonor template for mStayGold insertion into the N-terminus of the RAB7A locus. For endosome visualization. To be co-transfected with sgRNA plasmid px330-RAB7A (Addgene #227297)DepositorInsertRAB7A Homology Arms flanking a mStayGold Tag (RAB7A Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-GOLGA2
Plasmid#227325PurposeDonor template for mStayGold insertion into the N-terminus of the GOLGA2 locus. For Golgi visualization. To be co-transfected with sgRNA plasmid px330-PITCh-GOLGA2 (Addgene #207791)DepositorInsertGOLGA2 Homology Arms flanking a mStayGold Tag (GOLGA2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-PXN
Plasmid#227317PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the PXN locus. For focal adhesion visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PXN (Addgene #227315)DepositorInsertPXN Homology Arms flanking a mStayGold-2A-Puro Cassette (PXN Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Blast
Plasmid#227267PurposeEmpty AAVS1 targeting donor for the insertion of Blast and a strong EF1a promoter. A CDS can be cloned adjacent to the promoter via restriction or gibson cloning using the MluI cut site.DepositorTypeEmpty backboneUseCRISPR; Donor cassetteTagsExpressionMammalianMutationPromoterAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PEX3
Plasmid#227303PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PEX3 for knock-in.DepositorInsertsgRNA Targeting C-terminus of PEX3 (PEX3 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-RAB7A
Plasmid#227297PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of RAB7A for knock-in.DepositorInsertsgRNA Targeting N-terminus of RAB7A (RAB7A Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-haA3A-CBE-G-N
Plasmid#220898PurposeAAV genome encoding the N-terminal of haA3A-CBE-GDepositorInserthaA3A-CBE-G-N
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-haA3A-CBE-G-C
Plasmid#220899PurposeAAV genome encoding the C-terminal of haA3A-CBE-G, and sgRNADepositorInserthaA3A-CBE-G-C
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Top2A-5X Gly-Venus-T2A-Hygro
Plasmid#211115PurposeFor tagging the C-term of Top2A with VenusDepositorInsertsUseCRISPRTagsExpressionBacterial and MammalianMutationPromotern/aAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Zeo-H2BC11
Plasmid#207759PurposeDonor template for moxGFP-2A-Zeo insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Homology Arms flanking a moxGFP-Zeo Cassette (H2BC11 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPBpuro-EGFR(M721)
Plasmid#197379PurposeEncoding human ErbB1 mutant.DepositorInsertEGFR mutant (EGFR Human)
UseTagsExpressionMammalianMutationLysine 721 to MethioninePromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0471
Plasmid#142635PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertKAT7 (KAT7 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0470
Plasmid#142270PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertKAT7 (KAT7 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
KTK_002
Plasmid#180527PurposeEntry vector containing J23104 promoterDepositorInsertJ23104 promoter
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMT3928
Plasmid#113331Purposecontrol for Hermes transposition; LEU2 without flanking Hermes TIRs, recoded transposase driven by TEF1 promoterDepositorInsertsbeta-isopropyl malate dehydrogenase
codon-optimized Hermes transposase
UseUnspecifiedTagsExpressionMutationPromoterAvailable sinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
1GFP/RNase H1 D210N
Plasmid#174448PurposeExpress GFP-tagged RNase H1 D210N in E. coli.DepositorInsertRNase H1 (RNASEH1 Human)
UseTagsHis-tag, GFPExpressionBacterialMutationD210NPromoterT7 promoterAvailable sinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLAMP1-mCherry
Plasmid#45147DepositorInsertLAMP1-mCherry (LAMP1 Human, Synthetic)
UseTagsmCherryExpressionMammalianMutationPromoterCMVAvailable sinceJune 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-tdTomato
Plasmid#83029Purposeexpresses tdTomato fluorescent protein under the CAG promoterDepositorInserttdTomato
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceSept. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
Luciferase-pcDNA3
Plasmid#18964DepositorInsertFirefly Luciferase
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRSETB/mStayGold(c4)
Plasmid#212018PurposeFor N-terminal tagging with mStayGold. c4 is the appendage that facilitates fusions to the C-terminus of mStayGold.DepositorInsertmStayGold(c4)
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pREDCas9
Plasmid#71541PurposeConstitutive expression of Cas9, inducible expression of the Red recombineering system, and inducible expression of the plasmid curing system for CRISPR mediated genome editing of E. coli.DepositorInsertsCas9
lambda red genes
plasmid curing system
UseTagsExpressionBacterialMutationPromoterpBADAvailable sinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA
Plasmid#71409PurposeThere is no gene/insert. It is a backbone plasmid that others can use to insert sgRNAs of interest. The cloning site for this BsmBIDepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR V7
Plasmid#86856PurposeFluorescent human androgen-receptor splice variant 7, lacking the ligand-binding domain (fused to EGFP)DepositorInsertAndrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationAlternative splice variant 7 (alteration/deletion…PromoterCMVAvailable sinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
EF1a-mito-dsRED2
Plasmid#174541Purposemitochondria targeted dsRED expressed off of EF1a promoterDepositorInsertMito
UseLentiviralTagsdsREDExpressionMammalianMutationPromoterEF1aAvailable sinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
FokI-dCas9
Plasmid#52970PurposeExpresses Fok1 nuclease domain fused to catalytically inactive Cas9 DNA-binding domain in mammalian cellsDepositorInsertFok1 fused to dCas9
UseCRISPRTagsFok1 nuclease (homodimeric wildtype) and NLSExpressionMammalianMutationD10A and H840A in Cas9PromoterCMVAvailable sinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-4031NES
Plasmid#105241PurposeA Förster resonance energy transfer (FRET) biosensor for AMPK activity with cyan and yellow fluorescent protein.DepositorInsertAMPK-EV
UseTagsExpressionMammalianMutationPromoterCAGGSAvailable sinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry-SEpHluorin
Plasmid#32001DepositorInsertmCherry
UseTagsSuperecliptic pHluorinExpressionMammalianMutationPromoterAvailable sinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only