We narrowed to 9,067 results for: sgRNA
-
Plasmid#75391PurposesgRNA1-2XboxBDepositorInsertsgRNA1-2XboxB
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSG4K5
Plasmid#74492PurposeFor cloning and constitutive expression of sgRNAs in E.coli. New sgRNAs are cloned into SapI sites and multiplex sgRNAs are cloned into BsaI sites. Kanamycin resistant with pSC101 origin of rep.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available sinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
L4440_BioBrick-sgRNA
Plasmid#177783PurposeOverexpression of sgRNAs in E. coli HT115, sgRNA overexpression scaffold; for ingestion by C. elegansDepositorTypeEmpty backboneExpressionBacterialAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-EN1201
Plasmid#92144PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse TIGRE acceptor locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspCas9-nuclease and sgRNA against mouse TIGRE acceptor locus
ExpressionMammalianAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lenti-sgRNA-BSD
Plasmid#175583PurposeExpresses sgRNA for CasRx in mammalian cellDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSgRNA
UseCRISPRAvailable sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKCcas9dO
Plasmid#62552PurposeHigh efficiency Streptomyces genome editing by CRISPR/Cas9 systemDepositorInsertsScocas9
sgRNA ()
act-orf4 homology arm
UseCRISPR; Bacterial genome editingExpressionBacterialPromoterj23119 and ptipAAvailable sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJY-RpABE
Plasmid#112872Purposebinary vector for ABE expression in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA cassette
UseCRISPRExpressionPlantAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTO136_pADH1-tRNA-Ala-gRNA-tracrRNA-HDV-tAgTEF2
Plasmid#171104PurposeExpresses sgRNA (ENO1 gRNA) in Candida auris.DepositorInsertsgRNA
ExpressionYeastPromoterADH1Available sinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO5.sgRNA.EFS.PAC
Plasmid#57825PurposeLentiviral Vector for Sp sgRNA delivery without SpCas9, Puromycin resistance, EFS Promoter drivenDepositorInsertssgRNA
EFS
PAC
UseCRISPR and LentiviralAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Cas12f-GE ver4.1
Plasmid#176544PurposeExpresses Cas12f-GE in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCas12f-GE ver4.1
Cas12f-GE ver4.1
ExpressionMammalianPromoterU6 and chicken β-actinAvailable sinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKS diaCas9_sgRNA
Plasmid#74923PurposeExpresses Cas9 codon optimized for Phaeodactylum tricornutum and a sgRNA driven by a U6 promoterDepositorInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPRPromoterCas9 module and sgRNA moduleAvailable sinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PLJR965
Plasmid#115163PurposeSth1 dCas9 TetR and KanR L5 Int attP for M. tuberculosisDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsSth1 sgRNA scaffold
Sth1 dCas9
TetR (deleted TetON) MtbCO
L5 attP
L5 Int
KanR
UseUnspecifiedAvailable sinceSept. 14, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
psgRNA
Plasmid#114005Purposeexpress sgRNA. ColE1, KanDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA
PromoterBBa_J23119Available sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PU6::klp-12_sgRNA
Plasmid#46170Purposeklp-12 targeting sgRNADepositorInsertklp-12 targeting sgRNA (klp-12 Synthetic)
UseCRISPRExpressionWormPromoterC. elegans U6 snRNA pol III promoterAvailable sinceJuly 1, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgRNA 2 GAPDH
Plasmid#83809PurposeExpress Sg-2 sgRNA targeting GAPDHDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSgRNA
UseCRISPRAvailable sinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFD5
Plasmid#73914Purposemultiplex gRNA plasmidDepositorInsertdU6-3:tRNA:gRNA:tRNA:gRNA
UseCRISPRExpressionInsectPromoterdU6:3Available sinceMarch 29, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX601 miniCMV-SaCas9-SpA-sgRNA scaffold
Plasmid#107055PurposeBackbone vector for cloning in target sgRNA for use with SaCas9 (SauCas9)DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PB-sgRNA(MS2)
Plasmid#102560PurposePiggybac transposon sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR; Piggybac transposonExpressionMammalianPromoterU6Available sinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by