We narrowed to 7,666 results for: trac
-
Plasmid#223551PurposeHis-tagged human PHD2 catalytic domain with TEV cleavage site between His and PHD2 for PHD2 purificationDepositorInsertPHD2 (EGLN1 Human)
Tags6x HisExpressionBacterialMutationDeleted amino acids 1-180.PromotertrcAvailable SinceSept. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-IDH1-R132H-FLAG
Plasmid#66803PurposeTet-inducible expression of mutant IDH1 in mammalian cells, 3rd generation lentiviral vectorDepositorInsertIDH1 (IDH1 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationR132HPromoterCMVAvailable SinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma2-GFP2
Plasmid#166774PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma2-GFP2 (GNG2 Synthetic, Human)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaActin binding domain
Plasmid#187276PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Actin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaActin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaMyosin binding domain
Plasmid#187275PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Myosin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaMyosin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinA740D, E758K
Plasmid#187273PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationAnillin A740D, E758KPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MARCer-Blast
Plasmid#160550Purposelabeling hypoxic cellsDepositorAvailable SinceDec. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKSR1-CA3-GS-EGFP (C-KSR-GS)
Plasmid#217757PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 with GGSSGGGGA linkerPromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5/FRT/TO-GAlphai1-RLuc8
Plasmid#140973PurposeEncodes a G alpha subunit (GNAl1) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphai1-RLuc8 (GNAI1 Human)
UseSynthetic BiologyExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 (NT17)
Plasmid#49085PurposeExpresses human NKCC1 with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma9-GFP2
Plasmid#140991PurposeEncodes a G gamma subunit (GNG9) containing GFP2 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphaQ-RLuc8
Plasmid#140982PurposeEncodes a G alpha subunit (GNAQ) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphaQ-RLuc8 (GNAQ Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlpha15-RLuc8
Plasmid#140984PurposeEncodes a G alpha subunit (GNA15) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlpha15-RLuc8 (GNA15 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma10-GFP2
Plasmid#166779PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma10-GFP2 (GNG10 Synthetic, Human)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma5-GFP2
Plasmid#166777PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma5-GFP2 (GNG5 Synthetic, Human)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGS_101
Plasmid#160541PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma4-GFP2
Plasmid#166776PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma4-GFP2 (GNG4 Synthetic, Human)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGS_107
Plasmid#160650PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
NONO2_IDR-EGFP
Plasmid#232758PurposeExpresses NONO2_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-AREG-ScNeo
Plasmid#209897PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Beta1
Plasmid#140987PurposeEncodes a Gbeta subunit (GNB1) as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGBeta1 (GNB1 Human)
ExpressionMammalianMutationContains an N-terminal human rhinovirus (HRV) 3C …PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-M13-6His-KIF1C-GFP
Plasmid#130975PurposeExpression of 6His-KIF1C-GFP in insect cells for protein purification.DepositorInsertKIF1C-GFP (KIF1C Human)
Tags6His and GFPExpressionInsectMutation5 silent mutations that make this construct RNAi …PromoterPolyhedrinAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
EGFPC2-Gephyrin P1
Plasmid#68815Purposeexpression of fluorescent tagged Geph in mammalian cellsDepositorInsertGephyrin (Gphn Rat)
TagsEGFPExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyri…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-PLXNB2-shRNA1
Plasmid#98399PurposeLentivirus for expression of shRNA1 against human PLEXIN-B2 (Dox-inducible)DepositorInsertPlexin-B2 (PLXNB2 Human)
UseLentiviralAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FRB-SpCas9-A
Plasmid#138477PurposeExpresses FRB fused SpCas9 for NanoMEDIC packaging.DepositorInsertSpCas9, human codon optimized
UseCRISPRTags3x HA tag and FRBExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-AREG-ScNeo
Plasmid#209910PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphaGustducin-RLuc8
Plasmid#140979PurposeEncodes a G alpha subunit (GNAT3) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphaGustducin-RLuc8 (GNAT3 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
tetO-HAND2
Plasmid#170690Purposedoxycycline-inducible overexpression of HAND2DepositorInsertHAND2 (HAND2 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianPromoterTRE promoter, Tet-ONAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EREG-ScNeo
Plasmid#209896PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
UseLentiviralTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EPGN-ScNeo
Plasmid#209899PurposeTo monitor the status of Epigen, the plasmid encodes a recombinant Epigen fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL 5N>Q
Plasmid#202419PurposeExpression of GFP-tagged PODXL with mutated N-linked glycosylation sitesDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATX3-13Q
Plasmid#184248PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track (ATXN3 Synthetic, Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationC-terminal codon optimization for protein expres…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSH1/M-FGFR1-Fv-Fvls-E
Plasmid#15285DepositorInsertFGFR1 kinase, FKBP12v36 (Fgfr1 Mouse)
TagsHA epitope and Myristoylation-targeting domain c-…ExpressionMammalianMutationFGFR1 cytoplasmic domain FKBP12 F36VAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H326
Plasmid#228242PurposemT2Del_EPACdDEPCD_Q270E_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H327
Plasmid#228243PurposemT2Del_EPACdDEPCD_Q270E_M312L_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_M312L_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H328
Plasmid#228244PurposemT2Del_EPACdDEPCD_Q270E_M312L_E325T_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_M312L_E325T_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H329
Plasmid#228245PurposemT2Del_EPACdDEPCD_Q270E_E325T_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_E325T_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EGF-ScNeo
Plasmid#209893PurposeTo monitor the status of EGF, the plasmid encodes a recombinant EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-HBEGF-ScNeo
Plasmid#209894PurposeTo monitor the status of HB-EGF, the plasmid encodes a recombinant HB-EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-Dlx-SynaptoTAG
Plasmid#210729PurposeAAV vector for mapping synaptic projections. GABAergic neuron-specific Dlx promoter expresses EGFP-Synaptobrevin-2 to label synaptic terminals and Palm-tdTomato to label neuronal soma and axons.DepositorInsertEGFP-Synaptobrevin-2, P2A, Palm-tdTomato (tdTomato with Palmitoylation sequence) (Vamp2 Synthetic, Rat)
UseAAVPromoterDlxAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-EREG-ScNeo
Plasmid#209905PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
TagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRY2high-mCherry-Raf1
Plasmid#104064PurposeExpresses fusion of CRY2high mutant (CRY2PHR E490R) with mCherry and Raf1DepositorExpressionMammalianMutationCRY2PHR E490RPromoterCMVAvailable SinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin P1
Plasmid#68816PurposeFlag tagged Geph mammalian expressionDepositorInsertGephyrin (Gphn Rat)
Tags3xFLAGExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyrin…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHOT-P2Y2R
Plasmid#159108Purposeentiviral vector encoding P2Y purinoceptor 2 (P2Y2R), a high affinity G-protein coupled receptor that mobilizes Ca2+ from intracellular stores upon binding extracellular ATP.48,49 By using the GibsonDepositorInsertP2Y2R
UseLentiviralPromoterUBCAvailable SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
mini-YFP-hDF-C2F-TM
Plasmid#72600Purposemini human dysferlin (from domain F to transmembrane ) tagged with YFPDepositorInsertdysferlin (DYSF Human)
TagsEYFPExpressionMammalianMutationfrom domain F to transmembrane domainPromoterCMVAvailable SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
FRIG-myc-Sema4D-CD4
Plasmid#51606Purposeexpresses myc-tagged Sema4D/CD4 non-cleavable chimera with extracellular Sema4D, intracellular CD4 in lentiviral backboneDepositorInsertSema4D/CD4-FLAG (Sema4d Mouse, Human)
UseLentiviralTagsFLAG and mycExpressionMammalianMutationSema4D amino acids 660-861 were replaced with CD4…PromoterRSVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only