We narrowed to 26,538 results for: RON
-
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-20XUAS-IVS-Syn21-Positron2-p10
Plasmid#239082PurposeGal4 activated transgene expression of positive-going voltage sensor under the hsp70 promoter in D. melanogasterDepositorInsertPositron2
ExpressionInsectMutationR78K N81D D92N W178FPromoterhsp70Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
T7pro-tRNA-ITSIle intron-T7tVar1-pRS426
Plasmid#239294PurposeExpresses the tRNAIle intron bearing the 5' GGGAGA initially transcribed sequence (ITS); Plasmid #2 of the tet-on overexpression systemDepositorInsertsT7 promoter
ITS-tRNAIle intron
T7 terminator - Var1
ExpressionYeastAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-STIM1 WPRE
Plasmid#236233PurposeAAV expression of mouse STIM1 internally tagged with HaloTagDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-Sec61b WPRE
Plasmid#236229PurposeAAV expression of a marker for the endoplasmic reticulum, Sec61b, fused to HaloTagDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mScarlet-STIM2 WPRE
Plasmid#236236PurposeAAV expression of human STIM2 internally tagged with mScarlet-IDepositorInsertmScarletI-STIM2 (STIM2 Human)
UseAAVTagsmScarletI in position 29MutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-Sec61b WPRE
Plasmid#236228PurposeAAV expression of a marker for the endoplasmic reticulum, Sec61b, fused to mEmerald.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-STIM1 WPRE
Plasmid#236234PurposeAAV expression of mouse STIM1 internally tagged with mEmeraldDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-STIM2 WPRE
Plasmid#236235PurposeAAV expression of human STIM2 internally tagged with HaloTagDepositorInsertHaloTag-STIM2 (STIM2 Human)
UseAAVTagsHaloTag in position 29MutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-Structural polyprotein with Nluc tagged E2
Plasmid#215699PurposeProduces the Chikungunya virus structural polyprotein Capsid-E3-NLucE2-6K-E1DepositorInsertCHIKV structural polyprotein Capsid-E3-NLucE2-6K-E1
ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX552 EF1a DIO Chronos GFP_Vgat gRNA
Plasmid#215277PurposeExpresses Vgat gRNA in a Cre dependent Chronos GFP vectorDepositorInsertVgat gRNA
UseAAVExpressionMammalianPromoterU6Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552 EF1a DIO Chronos GFP_VgatTTT gRNA
Plasmid#215278PurposeExpresses Vgat Control gRNA in a Cre dependent Chronos GFP vectorDepositorInsertVgat control gRNA
UseAAVExpressionMammalianPromoterU6Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC-N SARS-CoV-2 Omicron spike protein
Plasmid#180779PurposeSars-CoV-2 variant proteinDepositorInsertMAC-N SARS-CoV-2 Omicron spike protein
TagsMAC-tagExpressionMammalianMutationS371L, H69-V70-, S373P, S375F, G339D, N211-, N440…Available SinceSept. 26, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-Synapsin-NLS-Dronpa-optoNES-WPRE
Plasmid#159944Purposeoptical regulation of nuclear exportDepositorInsertNLS-Dronpa-optoNES
UseAAVExpressionMammalianMutationsyntheticPromoterhSyn1Available SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral human Citron shRNA 1 RFP i670
Plasmid#155345PurposeLentiviral expression of humnan CIT shRNA, RFP i670 expression, based on Addgene 12247DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated N-terminal (N) O-Glycosylation site
Plasmid#120404Purposeenables eukaryotic expression of human plasma fibronectin in which the first O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContaining complete variable region with a mutati…PromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA/EF1a-mCherry-WPRE-pa
Plasmid#233034PurposeTo Express HA tagged hfCas13d the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInserthfCas13d and mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DjCas13d-pA/EF1a-mCherry-WPRE-pa
Plasmid#233033PurposeTo Express HA tagged DjCas13d the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInsertDjCas13d and mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Dlx5/6-Chronos-eGFP-p2a-nls-mScarlet
Plasmid#121543PurposeChronos with red nucleus-targeted fluorescence for inhibitory neuronsDepositorInsertblue-absorbing channelrhodopsin Chronos with eGFP and nls-mScarlet
UseAAVPromoterdlx5/6Available SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only