-
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
UseTagsExpressionMutationPromoterQuorum sensing promoterAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 GFP V3
Plasmid#226961PurposeCBh-SaCas9-2A-GFP, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
SaCas9 GFP V3
Plasmid#226962PurposeCBh-SaCas9-2A-GFP, and hU6-sgRNA (Sa) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 puro V3
Plasmid#226960PurposeCBh-SaCas9-2A-Puro, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRS-dCas9
Plasmid#220193Purposemini-Tn7 dCas9 expression vectorDepositorInsertPseudomonas aeruginosa-codon optimized Streptococcus pyogenes dCas9
UseCRISPRTagsExpressionBacterialMutationPseudomonas aeruginosa codon optimizedPromoterpromoterlessAvailable sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
CDS_Cas9-NLS
Plasmid#136121PurposePuchta Arabidopsis codon-optimised Cas9 for CRISPRDepositorInsertCDS_AtcoCas9-NLS
UseSynthetic BiologyTagsExpressionPlantMutationBsaI/ SapI domesticatedPromoterAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDS12_Cas9-NLS
Plasmid#136122PurposePuchta Arabidopsis codon-optimised Cas9 for CRISPR. CDS12 for N-term fusion with a CTAGDepositorInsertCDS12_AtcoCas9-NLS(noStop)
UseSynthetic BiologyTagsExpressionPlantMutationBsaI/ SapI domesticatedPromoterAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationH840A and D10A mutations on spCas9 to inactivate …PromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0526-sgRNArodA
Plasmid#149658Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, P0526Available sinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_COL4A3_self-cleavingCas9
Plasmid#130281PurposeExpresses an spCas9 under the control of a CMV promoter; The spCas9 is flanked by COL4A3 sgRNA targets to induce its self-cleaving and inactivationDepositorInsertspCas9
UseAAVTagsExpressionMutationPromoterCMVAvailable sinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_COL4A5_self-cleavingCas9
Plasmid#130282PurposeExpresses an spCas9 under the control of a CMV promoter; The spCas9 is flanked by COL4A5 sgRNA targets to induce its self-cleaving and inactivationDepositorInsertspCas9
UseAAVTagsExpressionMutationPromoterCMVAvailable sinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_PflaBS-sgRNAflaB
Plasmid#149643Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, PflaBSAvailable sinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0826L-sgRNAflaB
Plasmid#149648Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, P0826LAvailable sinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_Psyn-sgRNArodA
Plasmid#149655Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_PresTS-sgRNAflaB
Plasmid#149644Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, PresTSAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_PresTL-sgRNAflaB
Plasmid#149645Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, PresTLAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0026-sgRNAflaB
Plasmid#149646Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, P0026Available sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0826S-sgRNAflaB
Plasmid#149647Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, P0826SAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_Psyn-sgRNAftsI
Plasmid#149649Purposeall-in-one CRISPRi vector for targeting B. burgdorferi ftsIDepositorInsertdCas9, lacI, sgRNAftsI
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0526-sgRNAftsI
Plasmid#149650Purposeall-in-one CRISPRi vector for targeting B. burgdorferi ftsIDepositorInsertdCas9, lacI, sgRNAftsI
UseCRISPRTagsExpressionBacterialMutationPromoterPflaB, PpQE30, P0526Available sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSM-dCas9::Ap
Plasmid#154307PurposeShuttle vector for expression dCas9, mobilization cluster, expresses the tracrRNA and a CRISPR array designed for the easy cloning of new spacers.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR-L3-Cas9n-L2
Plasmid#141039PurposeMutisite Gateway mediated vector constructionDepositorInsertCas9n
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-T3-HypaCAS9-pA
Plasmid#131467PurposeExpresses HypaCas9 nuclease in mammalian cells. Used to modify genome of mouse embroysDepositorInsertCodon optimized HypaCas9
UseCRISPRTagsFlag, NLS, and polyAExpressionMammalianMutationPromoterAvailable sinceNov. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-21a_3xNLS_SpCas9_protein_expression
Plasmid#114365PurposeProtein expression plasmid for 3xNLS SpCas9 in pET-21a backboneDepositorInsert3xNLS_SpCas9
UseCRISPRTagsNLSExpressionBacterialMutationPromoterT7Available sinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRx-Sth1Cas9-L5
Plasmid#140993PurposeSth1Cas9, TetR, KanR, L5Int, attP to create frameshifts and gene deletion in MycobacteriaDepositorInsertsSth1Cas9
TetR
L5 attP
L5 Int
KanR
UseUnspecified; Integrative in mycobactreiaTagsExpressionMutationPromoterAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-miniTurbo
Plasmid#219822PurposeEF1α-driven expression of dCas9 fused to miniTurbo with GFP (Adapted from plasmid #153209)DepositorInsertdCas9
UseCRISPRTagsminiTurboExpressionMammalianMutationD10A/H841APromoterEF1aAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-dCas9
Plasmid#125687PurposeGene knockdown for actinomycetesDepositorInsertstreptomyces codon optimized spdCas9, sgRNA casette
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterermE*/tipAAvailable sinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZ8-T_dCas9
Plasmid#74062PurposepZ8-1 plasmid carrying dcas9, driven by the IPTG-inducible Ptac promoter, KanRDepositorInsertdcas9
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterptacAvailable sinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
HBT-pcoCas9
Plasmid#52254Purposetransient expression of pcoCas9 gene in plant cellsDepositorInsertpcoCas9
UseCRISPR; Plant expressionTagsFLAG and NLSExpressionMutationPromoterhybrid constitutive promoter 35SPPDKAvailable sinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_gRNA1TERTKO_BsagRNA5tertko_2A-GFP
Plasmid#198863PurposePlasmid encoding for 2 gRNAs targeting the human TERT geneDepositorInsertTERT sgRNA (TERT Human)
UseTagsExpressionMammalianMutationPromoteru6Available sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHdzCas9-KRAB
Plasmid#92341PurposeExpression dzCas9-KRAB in microalgae. CRISPR/Cas based plant genome editing and gene regulation, Hyg resistanceDepositorTypeEmpty backboneUseCRISPR; Plant expressionTagsKRABExpressionPlantMutationPromoterCaMV35SAvailable sinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas9-beta
Plasmid#169240PurposeCas9 and beta expression plasmid for performing gene knockouts via oligo recombineeringDepositorInsertscas9
beta
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pACT2-CAS9c
Plasmid#51055PurposeExpress Eukaryotic-codon-optimized Cas9c gene in yeast under ADH1 promoter for genome editing. SV40 NLS is fused to the C terminal. GAL4 region from pACT2 is removed.DepositorInsertCas9c
UseCRISPRTagsSV40 NLSExpressionBacterial and YeastMutationPromoteryeast ADH1 promoterAvailable sinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHCas9-Nours
Plasmid#107733PurposeEscherichia coli- S. cerevisiae shuttle plasmid harbors a Cas9 gene, a natMX6 and URA3 selection markers used in S. cerevisiaeDepositorInsertCas9
UseCRISPRTagsSV40 NLSExpressionYeastMutationHuman optimizedPromoterTEF1Available sinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_AAN_4
Plasmid#231415PurposeThis AND-AND-NOT-gate plasmid expresses dCas9 from a constitutive promoter. Its sgRNAs X & Y are repressible by sgRNAs A & B, respectively. Its GFP gene is repressible by any of sgRNAs X, Y, and C.DepositorInsertsdCas9
GFP
sgRNA-X
sgRNA-Y
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Blast_HP1beta_gRNA
Plasmid#127908PurposeWT Cas9 Vector with Blasticidin Selection Marker targeting the 5' end of the human HP1beta geneDepositorInsertgRNA for Human 5' HP1beta
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCas9-Blast
Plasmid#52962PurposeExpresses human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance from EFS promoter. 3rd generation lentiviral backbone.DepositorHas ServiceLentiviral PrepInsertsCas9
Blasticidin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationPromoterEFS-NSAvailable sinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only