We narrowed to 9,360 results for: CAG
-
Plasmid#90469PurposeLentiviral vector expressing a doxycycline-inducible shRNA against human CUX1 sequence starting at 5150 of M74099DepositorInsertTGCTGTTGACAGTGAGCGTCAGAGCGATAATACACTATTATAGTGAAGCC
UseLentiviral and RNAiExpressionMammalianAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB3050(gRNA XII-5)
Plasmid#73292PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSC44
Plasmid#104818PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pCfB3044(gRNA XI-2)
Plasmid#73286PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJG493
Plasmid#91197PurposeWDV replicon T-DNA for gene targeting in wheat scutella, no Cas9 control (gUbi1+gUbi8+donor)DepositorInsertgUbi1+gUbi8+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD1_3
Plasmid#36367DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
TRIN-E-shTAF12.376
Plasmid#105573PurposeDox-inducible mirE TAF12 shRNA/dsRED expression with GFP marker and neo resistanceDepositorInsertTAF12 shRNA
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
p230-pOsAct1::hpt-pZmUbi::BdPetC
Plasmid#129649PurposeRieske FeS overexpressionDepositorInsertCDS of PetC gene encoding for the Rieske FeS subunit
ExpressionPlantMutationCodon modified for Golden GatePromoterpZmUbiAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAE-MIBP1
Plasmid#51873PurposeExpresses full length rat MIBP1 (cloned in pCAGGS)DepositorAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJG484
Plasmid#91194PurposeWDV replicon T-DNA for gene targeting in wheat scutella, H840A single nickase (nTaCas9_H840A+gUbi8+donor)DepositorInsertnTaCas9_H840A+gUbi8+donor
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
sh-Myocardin
Plasmid#100768Purposeexpression of shRNA targeting MYOCDDepositorInsertsh-Myocardin
UseRNAiPromoterH1Available SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shPIK3CD.v2 puro
Plasmid#58707PurposeLentiviral shRNA vector for knockdown of human PIK3CDDepositorAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-lpoB
Plasmid#89959PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting lpoB.DepositorInsertlpoB gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
DJ-L1 gRNA #5
Plasmid#247545PurposeCRISPRi-KD of human DJ LINE1DepositorInsertsgRNA targeting human L1DJ
UseCRISPRExpressionMammalianMutationnoneAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_TIMM23_Puro_T2A_BFP2
Plasmid#236731PurposeDual sgRNA targeting TIMM23 expressing BFP with Puromycin selectionDepositorInsertTIMM23 (TIMM23 Human)
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_TIMM23_ER-dAPEX-BFP2
Plasmid#236734PurposeDual sgRNA targeting TIMM23 expressing dAPEX-BFP targeting to ERDepositorInsertTIMM23 (TIMM23 Human)
UseCRISPR and LentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-26 (nonfunctional)
Plasmid#246309PurposeEvaluation of MtU6.6m7 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m7 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationC-to-A (-63 from TSS), T-to-G (-57)PromoterMtU6.6m7 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RPPH1 (pAVA3585)
Plasmid#239262PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG022
Plasmid#231306PurposeVector part for BEVA; BEVA2.0 Position 1 Level 1 BsaI cloning site with alternate CAGA 3' fusion site, without T0, AmpRDepositorInsertBEVA2.0 Position 1 Level 1 BsaI cloning site with alternate CAGA 3' fusion site, without T0, AmpR
ExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-MYD88-ts2
Plasmid#174281PurposeMYD88 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_162
Plasmid#216092PurposeCas9 [Sp] CRISPRi targeting CD47, positive controlDepositorInsertCD47 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_832
Plasmid#216085PurposeCas9 [Sp] knockout targeting CD47, positive controlDepositorInsertCD47 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-21_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211671PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-21 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
1114H
Plasmid#200640PurposeAn. gambiae transgenesis plasmid. Expresses gRNAs targeting B2-tubulin, ZPG, and DSXF. Crossing to Cas9 generates sterile malesDepositorInsertgRNA targeting DSXF, ZPG, and B2-tubulin. Actin5c-CFP and Vasa2-EYFP reporters.
UseCRISPRExpressionInsectAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC-cUnaG-LPETG
Plasmid#207635PurposeA plasmid encoding photocaged SpyCatcher (pSC) fused to C-terminal UnaG fragment and LPETG sortase recognition sequence.DepositorInsertphotocaged SpyCatcher-GGSGGGSG-cUnaG-LPETG
Tags6xHisExpressionBacterialMutationAmber stop codon at SC's critical lysinePromoterT7Available SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-tRNA
Plasmid#161761PurposeMODULE B tRNA vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2303 - #91068)DepositorInsertgRNAs
ExpressionBacterialPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-Csy4
Plasmid#161760PurposeMODULE B Csy4 vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2103 - #91061)DepositorInsertgRNAs
ExpressionBacterialPromoterCmYLCV PromoterAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mYwhae -2
Plasmid#198498Purposelentiviral stable expression of mYwhae gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mYwhae - 1
Plasmid#198497Purposelentiviral stable expression of mYwhae gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10
Plasmid#197958PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by CmYLCVp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterCmYLCVp and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::hiw{sgRNA})
Plasmid#187884PurposeGal4/UAS sgRNA expression targeting hiwDepositorInsert4 sgRNAs targeting hiw
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW229-lenti-sg2-mmSerpinh1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189945PurposeLentiviral vector to co-express a mouse Serpinh1 spsgRNA (sg2-Serpinh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Serpinh1 spsgRNA #2
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato166/892
Plasmid#188488PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 166 & 892.DepositorInserttdTomato sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056J
Plasmid#183136PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK14 pCAS-Tyr-[gRNA: 4=XII-5] (SplitKanR, AmpR)
Plasmid#178998PurposeSp.Cas9 and gRNA yeast expression vector withXII-5 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shSpc25
Plasmid#160960PurposeSpc25 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS424-ysg(G:H)
Plasmid#138257PurposeExpression of GFP-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequence to be used in yeast dual reporter systemDepositorInsertGFP targeting sgRNAs G and H
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(G:H)
Plasmid#138259PurposeExpression of humanized mCherry-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequences to be used in Traffic Light reporter systemDepositorInsertmCherry targeting sgRNAs G and H
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDR-itga9_sgRNA4
Plasmid#132980Purposeitga9 sgRNA targeting to "5'-TCCGCTGCCAGCCAGCCGG-3" in pDR274DepositorInsertitga9 sgRNA4 target sequence
UseCRISPR; Sgrna generation vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.PAPD4-2
Plasmid#128757PurposeExpresses PAPD4 gRNA for CRISPRiDepositorAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL601 AG
Plasmid#126952PurposeTo target a protospacer with AG at the cut site.DepositorInsertspacer against human genome with AG at cut site
ExpressionMammalianPromoterhuman U6Available SinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga2#2
Plasmid#122290PurposeKnockdown for mouse Hmga2DepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Geph UTR3m shRNA
Plasmid#121071PurposeNegative control shRNA for plasmid 121070: shRNA targeting the 3'-untranslated region (UTR) of the gephyrin mRNADepositorInsertGPHN shRNA (Gphn Rat)
UseRNAiAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
gh46
Plasmid#106709Purposeexpression of gRNA targeting ST6GALNAC5DepositorInsertST6GALNAC5 (ST6GALNAC5 Human)
ExpressionMammalianAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only