We narrowed to 402 results for: MUT
-
TypeCollection...different types of target sites available, both mutant and wild type. The ability to manipulate the number...Recombinase-mediated cassette exchange (RMCE): When matching but mutually incompatible recognition sites flank both a DNA...experimental results. Attenuated iCre(R297T), a point mutant iCre variant, reduces the number of recombination...
-
Luciferase Plasmid Collection
TypeCollection...Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow for increased...Renilla CMV Mammalian expression Renilla luciferase mutant Rluc8, which has increased stability and light ...luciferases : A set of three increasingly destabilized mutants which serve as sensors of proteome stress. pHLuc... -
Zhang Lab CRISPR Page
TypeCollection...loss-of-function mutations in p53 and Lkb1 , as well as homology directed repair-mediated Kras G12D mutations, leading...KRAS , p53 and LKB1 , the top three significantly mutated genes in lung adenocarcinoma. Delivery of a single... -
Fluorescent Protein Guide: Biosensors
TypeCollection...construct leads to a change in signal of a circularly permuted fluorescent protein (cpFP) or fluorescence resonance...Yasushi Okada ATP (extracellular) GRAB_ATP1.0/ATP1.0mut biosensor for extracellular ATP (Constitutive ...1147-1155. Lin Tian Endocannabinoid GRAB_eCB2.0/eCBmut biosensor for endocannabinoids in vivo (Constitutive...pHluorin2 for pH sensing The zebrafish merovingian mutant reveals a role for pH regulation in hair cell toxicity... -
Validated gRNA Sequences
TypeCollection...elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...CGGAGCTGATCACTGACA 72890 cut S. pyogenes 26429889 Katsanis GFPmut3b A. victoria ACCATCTAATTCAACAAGAATT 73221 interfere... 72628 cut S. pyogenes 26493208 Guigo, Johnson GFPmut3b synthetic ACCATCTAATTCAACAAGAATT 73224 interfere... -
CRISPR Guide
TypeGuide...developed by mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be... and a gRNA will result in a diverse array of mutations (see: Validate genetic modification ). In most...amino acid deletions, insertions, or frameshift mutations leading to premature stop codons within the open...targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the strength...strength of the knockout phenotype for a given mutant cell must be validated experimentally. Browse Plasmids...(nick) or no cuts. Cas9 nickase (Cas9n), a D10A mutant of SpCas9, has one active nuclease domain and one... -
Ginkgo Bioworks COVID-19 Collection
TypeCollection...SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5) Mutations Wild type (wt) Codon-optimized expression (recode...making pseudovirus (Ctrunc) ID Plasmid Description Mutations Tags Industry Additional Addgene Resources Blog... -
CRISPR Plasmids - Base Edit
TypeCollection...spectrum of single-nucleotide variants (somatic hypermutation) in a wider editing window, and are thus well...editing systems include targeted AID-mediated mutagenesis (TAM) from the Xing Chang lab and CRISPR-X from... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...ZFNs) are effective tools for making targeted mutations in zebrafish. With support from the NIH and guidance...):1471-1501. PubMed PMID 19798082 . Targeted mutagenesis in zebrafish using customized zinc-finger nucleases... -
AAV Molecular Tools
TypeCollection...-mPCSK9 hAAT-driven, constitutive Expression of mutant (D377Y) murine PCSK9 for studying hypercholesterolemia... microtubule-associated protein tau with P301L mutation 1 Tsuneya Ikezu 203840 pAAV-hSyn-Kir2.1WT-2A-mScarlet-KASH... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...name, capsid, and more. ID Plasmid Gene/Insert Mutations PI AAV Plasmids This table contains a general .... ID Plasmid Gene/Insert Vector Type Backbone Mutations Tags PI Do you have suggestions for other plasmids... -
Plant Plasmids and Resources
TypeCollection...(Link opens in a new window) for Targeted Gene Mutation in Rice - Yinong Yang. The MoClo CRISPR/Cas Toolkit...assembly for fast generation of multiple Arabidopsis mutants - Niko Geldner. CRISPR-Cas9 vector with GRF4-GIF1... -
Optogenetics Guide
TypeGuide...improve these natural opsins - by inducing point mutations to alter the absorption spectrum or adding trafficking... variants have been created via genetic point mutations, codon optimization, and chimeric fusion of domains...photocurrent compared to CrChR2 450 ChETA E123T mutation; creates faster kinetics but reduces photocurrent...photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step function...function Opsins and Stabilized Step Function Opsins. Mutations at C128 and D156 of CrChR delay the closing of...Chlamydomonas noctigama . ChrimsonR carries K176R mutation. 590 PsChR2 High-efficiency blue-shifted channelrhodopsin... C1V1 ChR1-VChR1 chimera with E122T and E162T mutations 540 Channelrhodopsins: chloride channels iChloC... -
Plan Your Experiment
TypeGuide...(knockout)? Generate a specific mutant allele of a gene (point mutant)? Increase or decrease expression...Furthermore, in cells containing two mutated alleles, each mutated allele may be different owing to the...many different types of edits, including point mutations, base changes, and large insertions or deletions...) Generate specific genomic edits, like point mutations or small tag insertions, by copying from a DNA...Generate targeted insertions, deletions, and point mutations using a prime editing guide RNA (pegRNA) Prime... alternative splicing, and an early frameshift mutation is more likely to result in a non-functional protein...base editing , or prime editing experiments, most mutated alleles will not contain the desired edit. Even... -
Zebrafish Plasmid Collection
TypeCollection...Keith Joung Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9... typically relies on genetic markers, somatic mutations, or labeling with fluorescent proteins to visualize... -
Ras Pathway
TypeCollection...regulating the growth of the cell, however when mutations occur in the Ras gene it can be stuck in a constitutively...PubMed PMID: 17428555 . RAS signaling pathways, mutations and their role in colorectal cancer. Zenonos K... -
CRISPR Plasmids - Tagging
TypeCollection...systematic and scalable method to create marker-free mutations, insertions, and deletions at any locus in C. ... 10-day protocol, generates “clean” homozygous mutants with no co-integrated markers or footprints, and... -
Retrograde AAV viral preps
TypeCollection...Norepinephrine sensor Yulong Li 123310 pAAV-hSyn-GRAB_NEmut Syn GRAB-NEmut control norepinephrine sensor (does not... -
CRISPR Pooled gRNA Libraries
TypeCollection...with the pooled library to create a population of mutant cells that are then screened for a phenotype of...Human Wei 3rd Varies 12,472 pairs HR700_TP53 Exon Mutation Libraries 229137–229140 Donor Vector Human Stiewe... -
Adeno-associated virus (AAV) Guide
TypeGuide... create and test capsid libraries with random mutations or insertions in the Cap region. Several methods...immune response, and the low risk of insertional mutagenesis. Several AAV-based gene therapies have been approved...chromosome, which reduces the risk of insertional mutagenesis. However, random integration events can occur...host organism, leading to disease. Insertional mutagenesis Random insertion of DNA elements into the genome...material into cells. Replication-competent rAAV Mutated rAAV vector that has the ability to replicate and... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...contain the A206K mutation are monomeric at all concentrations, so this is mutation is noted when present... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...sgUPRT 54467 Other/Toxoplasma gondii none, Q5 mutagenesis yes, cut S. pyogenes Sibley pU6-Universal 52694...Gateway recombination. Qi Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs... -
Immunology Research Plasmids and Resources
TypeCollection...arginine-rich, mutated in early stage tumors ARP, MANF, MGC142148, MGC142150 ARMETL1 arginine-rich, mutated in early..., DC-SIGN, DC-SIGN1, MGC129965 CD4 CD4 molecule CD4mut CD74 CD74 molecule, major histocompatibility complex...FLJ79544, FLJ94613, MGC138597, T3G CD4 CD4 molecule CD4mut CD40LG CD40 ligand CD154, CD40L, HIGM1, IGM, IMD3...consists of 182 wild-type and 19 well-characterized mutant ORFs that represent over 25 cellular signaling ... -
Lentiviral Vector Guide
TypeGuide...harnessed for stable delivery of various genes, mutations, or treatments into cells, and has been widely... the laboratory, and many have been removed or mutated for increased safety. Figure 1: Wild-type lentivirus...biological processes by surveying a pool of genetic mutants for various phenotypes. These screens involve hundreds...used to create transgenic mice with heritable mutations or transgene expression. Popular uses include ... -
Chemogenetics Guide
TypeGuide...? blog! Studies of GPCRs led to development of mutated receptors that while unresponsive to endogenous...PSEMs). PSAM domains were first named for the mutations that allowed them to respond to their cognate ...anti-smoking drug varenicline. This PSAM carries mutations at L131G, Q139L, and Y217F and is termed PSAM4... -
Adenovirus Guide
TypeGuide...highly reduces the potential for insertional mutagenesis and the risk of oncogenesis. However, random ... signals of infection or damage. Insertional mutagenesis Random insertion of DNA elements into the genome... cells. Replication-competent adenovirus (RCA) Mutated adenoviral vector that has the ability to replicate... -
Browse
TypeCollection...Plasmids Plasmid Gene/Insert Vector Type Backbone Mutations Tags Industry PI... -
The SGC Oxford Collection
TypeCollection...Oxford Plasmid Gene/Insert Vector Type Backbone Mutations Tags PI... -
The SGC Stockholm Collection
TypeCollection...Plasmids - Stockholm Plasmid Gene/Insert Vector Type Mutations Tags Industry PI... -
The SGC Toronto Collection
TypeCollection...Toronto Plasmid Gene/Insert Vector Type Backbone Mutations Tags Industry PI... -
Cell Migration Consortium Plasmids
TypeCollection...Plasmids ID Plasmid Gene/Insert Vector Type Backbone Mutations Tags PI... -
TREAT-AD Plasmid Collection
TypeCollection.... ID Plasmid Gene/Insert Vector Type Backbone Mutations Tags PI... -
Michael J Fox Foundation (MJFF) Plasmid Collection
TypeCollection...search the table below. ID Plasmid Gene/Insert Mutations Industry Return to top MJFF Shared Research Tools... -
CRISPR Plasmids - RNA Editing
TypeCollection...making it a very flexible editing system. The T375G mutation reduces off-target effects of ADAR2 by destabilizing... -
Resolute Plasmid Collection
TypeCollection...approximately 450 identified members. Many SLCs have mutations associated with disease and could become targets... -
Mammalian RNAi Tools
TypeCollection...or to knockdown genes with potentially harmful mutations in therapeutic settings. As a tool in mammalian... -
CRISPR Plasmids and Resources
TypeCollection...enzymes generate double strand breaks (DSBs). Nick Mutated Cas nickase enzymes generate single-strand DNA ... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...modification, or variant. ID Plasmid Description Mutations Industry PI Due to export control regulations,... -
Adenovirus Plasmids
TypeCollection...modular inserts for seamless assembly of multiple mutations, alterations, or transgene insertions into single... -
Retrovirus Plasmids
TypeCollection... can lead to oncogenesis (termed insertional mutagenesis). Read our γ-Retrovirus Guide for more information... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...disulfide bridges such as antibodies. MCP-tag is a mutant of ACP-tag, and is labeled by SFP Synthase but ... -
Viral Vector Guides and Plasmids
TypeCollection...replication-incompetent. Specific genes have been mutated or deleted to prevent uncontrolled viral replication... -
Antibody Plasmid Collection
TypeCollection...isotype-switched chimeric antibodies, and Fc-silent mutants. Functional diversification of hybridoma-produced... -
mTOR Pathway
TypeCollection...multiple familial cancers are caused by inactivating mutations in negative regulators of mTORC1. The hyperactivation... -
Distribution to Industry
TypeCollection...Library name Type PI Description HR700_TP53 Exon Mutation Libraries CRISPR Thorsten Stiewe Use these donor... -
TALEN Guide
TypeCollection...in a C. elegans lab and have been struggling to mutate a specific gene or your anxiously investigating... -
Viral Production
TypeCollection...for viral production are propagated in the endA -mutated NEB Stable strain of E. coli . In addition, plasmids... -
Lentivirus Plasmids
TypeCollection... genome, it has the potential for insertional mutagensis. The 2nd and 3rd generation lentiviral systems... -
Optogenetics AAV Preps
TypeCollection...Excitatory Wild-type ChR2 ChR2/H134R soCoChR ChR2/other mutants Chronos, Chrimson, ChRmine, ChroME, ChETA, C1V1... -
Plasmids for Stem Cell Research
TypeCollection... cell division, all of which lower the risk of mutation and minimize tumorigenicity, an inherent disadvantage...