We narrowed to 8,876 results for: sgrna
-
Plasmid#75876Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
LentiGuide-Puro-P2A-EGFP_mRFPstuf
Plasmid#137730PurposeExpresses customizable S. Pyogenes sgRNA from U6 promoter and PuroR-P2A-EGFP from EF-1a promoter. Stuffer contains mRFP from a bacterial promoter, enabling simple visual quality control step of sgRNADepositorTypeEmpty backboneUseCRISPR, Lentiviral, Mouse Targeting, and Syntheti…ExpressionBacterial and MammalianAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK1 gRNA (BRDN0001162524)
Plasmid#77050Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-FOXL2-cterm
Plasmid#192893PurposeExpresses Cas9 and sgRNA targeting the C-terminus region of FOXL2DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
GAG-CRErec
Plasmid#119971PurposeExpresses GAG (FMLV) fused with CRE recombinase for the production of VLPs loaded with CRE proteinDepositorInsertGAG-nlsCRErec
TagsnlsExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
Plasmid#83306PurposeLentivirus vector to express guideRNA and dCas9 with puro resistant geneDepositorInsertsgRNA and dCas9 from pX330
UseLentiviralTagsFLAG and PA tagsExpressionMammalianPromoterU6 for sgRNA and CBh for dCas9Available SinceDec. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
JAK1 gRNA (BRDN0001145887)
Plasmid#76392Purpose3rd generation lentiviral gRNA plasmid targeting human JAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK9 gRNA (BRDN0001162576)
Plasmid#77170Purpose3rd generation lentiviral gRNA plasmid targeting human CDK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK9 gRNA (BRDN0001146478)
Plasmid#77169Purpose3rd generation lentiviral gRNA plasmid targeting human CDK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001149212)
Plasmid#77051Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001149358)
Plasmid#77052Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001146195)
Plasmid#76082Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001146035)
Plasmid#76081Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001145294)
Plasmid#76083Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001146875)
Plasmid#76084Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR_071
Plasmid#164558PurposeHigher titer version of pXPR_053. Lentiviral vector that enables constitutive sgRNA expression. Also encodes the fluorophore violet-excited GFP (Vex) as a marker of transduction.DepositorInsertsgRNA cassette
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6Available SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK2 gRNA (BRDN0001146342)
Plasmid#75637Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BICstim-Gag-dCAS9-VPR
Plasmid#120922Purposeencodes a GAG-dCAS9-VPR fusion for targeted transcriptional activation.DepositorInsertGAG (FMLV)-dCAS9-VPR
TagsnoneExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK3 gRNA (BRDN0001146328)
Plasmid#77167Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK3DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Crimson
Plasmid#70683PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and Crimson reporter from EF-1a promoter. Lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Crimson Reporter
UseCRISPR and LentiviralExpressionMammalianPromoterEf1-a and hU6Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK12 gRNA (BRDN0001147156)
Plasmid#75915Purpose3rd generation lentiviral gRNA plasmid targeting human CDK12DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK12 gRNA (BRDN0001147294)
Plasmid#75916Purpose3rd generation lentiviral gRNA plasmid targeting human CDK12DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
Plasmid#64218PurposeExpression vector for sgRNA and for Expression of Cas9 linked to BFP via T2A linked to Ad4 E1B via P2ADepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E1BExpressionMammalianPromoterCBh and U6Available SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgHTT1-7sk-sgCas9
Plasmid#190900PurposeAAV-KamiCas9 vector expressing sgGFP and human HTT sgRNAsDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mcherry-P2A-Ad4E4orf6
Plasmid#64222PurposeExpression vector for sgRNA and for Expression of Cas9 linked via T2A to mCherry linked to the Ad4 E4orf6 gene via P2ADepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-mCherry-P2A-E4orf6ExpressionMammalianPromoterCBh and U6Available SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001146030)
Plasmid#77053Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001148937)
Plasmid#77054Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-P2A-EGFP
Plasmid#188898PurposeHuman lentiviral vector for expression of dCas9 with a C-terminal HA-2xNLS and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertdCas9
UseLentiviralTagsHA-2xNLS and P2A-GFPPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_070
Plasmid#164265PurposeLentiviral vector that enables Cre-mediated sgRNA expression. Also encodes the fluorophore violet-excited GFP (Vex) as a marker of transduction.DepositorInsertsgRNA cassette
UseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterHuman U6Available SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_hNT
Plasmid#71830PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and non-targeting control sgRNA for use in human cellsDepositorInsertNon-targeting sgRNA human (DNMT3A Synthetic, Human, S. pyogenes)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.1
Plasmid#59911PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-loxP-P2A-EGFP-loxP
Plasmid#188774PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgEIF3D-4
Plasmid#236766PurposeA piggybac-based vector containing mouse U6 promoter-driven EIF3D sgRNA #4 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertEIF3D sgRNA-4 (EIF3D Human)
UsePiggybacExpressionMammalianPromotermouse U6 promoter and mouse U6 promoter, CAG prom…Available SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2A gRNA (BRDN0001149181)
Plasmid#76414Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2A gRNA (BRDN0001148547)
Plasmid#76415Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.PAC
Plasmid#57828PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
Plasmid#64219PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2ADepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E1BExpressionMammalianPromoterCBh and U6Available SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
MINK1 gRNA (BRDN0001146260)
Plasmid#76260Purpose3rd generation lentiviral gRNA plasmid targeting human MINK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI)
Plasmid#64217PurposeExpression vector for sgRNAs cloned into the BbsI sites, shRNAs into BamHI & AflII and for Expression of Cas9 linked to mCherry via T2ADepositorInsertsCas9
hU6 promoter; BbsI sites for sgRNA
H1 promoter; BamHI site for shRNA
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianPromoterCBh, H1, and U6Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only