We narrowed to 13,226 results for: GFP expression plasmids
-
Plasmid#231909PurposeFor packaging EGFP, dTomato and firefly luciferase mRNA into SARS-CoV-2 virus-like particles (VLPs)DepositorInsertEGFP-P2A-dTomato-IRES-Luc
ExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ cMyc Dam_f_GFPoNLS
Plasmid#85820PurposeiDamID plasmid. To express transiently the c-Myc-tagged , L122A-mutant E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc Dam_f_GFPoNLS
TagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A.Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHBS1333 (IBB-GFP-mCherry 3E splicer)-(BFP-P2A-TDP43 G368W W385G)
Plasmid#107855PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationG368W and W385G in splicing reporterAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
human EB1-GFP mutagenized K148 K150 K151 all converted to A (JB144)
Plasmid#39305DepositorInsertEB1 (MAPRE1 Human)
TagsEGFPExpressionMammalianMutationK148A, K150A and K151APromoterCMVAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
human EB1-GFP mutagenized T249 D250 E251 all converted to A (JB146)
Plasmid#39307DepositorInsertEB1 (MAPRE1 Human)
TagsEGFPExpressionMammalianMutationT249A, D250A and E251APromoterCMVAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLEGFP-WT-STAT3
Plasmid#71450PurposeRetroviral expression of WT-STAT3. Please note that this plasmid contains WT-STAT3 tagged with FLAG, not GFP.DepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_G47E
Plasmid#101774PurposeExpresses mutant BAF (G47E) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationG47E mutationPromoterEF1aAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF
Plasmid#101773PurposeExpresses BAF in human cells (with EGFP produced from the same transcript as expression control)DepositorAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_L58R
Plasmid#101775PurposeExpresses mutant BAF (L58R) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationL58R mutationPromoterEF1aAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAIP Nup62Fv2GFP
Plasmid#139684PurposeNup62 dimerization construct fused to 2 copies of GFP under an SFFV promoterDepositorInsertNup62 (NUP62 Human)
UseLentiviralTags2 copies of GFP and Dimerization domain FKBPExpressionMammalianPromoterSFFVAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGFP FAK
Plasmid#50515PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorInsertprotein tyrosine kinase
TagsGFPExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-C1-AKT-PH
Plasmid#21218DepositorInsertAKT-PH
TagsGFPExpressionMammalianMutationPH domain of AKT. (Lab plasmid WC 0002).Available SinceJuly 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
GFP-C1-CAMKIIbeta
Plasmid#21227DepositorAvailable SinceJuly 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAdSh.U6.gRNAGFP
Plasmid#58255PurposeU6 promoter-driven single guide RNA complementary to eGFPDepositorInsertU6.gRNAGFP cassette
UseAdenoviral and CRISPRExpressionMammalianAvailable SinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
mAID(KR)–2×GFP NB(WT)
Plasmid#232304PurposeKR GFP adaptor for C. elegansDepositorInsertsKR GFP adaptor
OsTIR1(F74G)
ExpressionWormAvailable SinceJune 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLP-sfgfp
Plasmid#209994PurposeContains Level 0 Part: Coding sequences (sfGFP) for the construction of Level 1 plasmidsDepositorInsertsfGFP
ExpressionBacterialAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgGFP
Plasmid#190899PurposeAAV vector expressing sgGFPDepositorInsertsgRNA
UseAAV and CRISPRPromoterU6Available SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-FLAG
Plasmid#60360PurposePlasmid for cloning and expression of FLAG-GFP tagged proteins (C-terminal tag). Confers resistance to G418.DepositorHas ServiceCloning Grade DNATypeEmpty backboneTagsEGFP and FLAGExpressionMammalianPromoterCMVAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
EGFP-BAF_L58R
Plasmid#101776PurposeExpresses EGFP tagged mutant BAF (L58R) in human cellsDepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationL58R mutationPromoterEF1aAvailable SinceJan. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Rab8a-QL
Plasmid#86076PurposeA mammalian expression plasmid encoding Rab8a GTPase-deficient mutant (Rab8a-Q67L) with N-terminus EGFP.DepositorInserthRab8A (RAB8A Human)
TagsGFPExpressionMammalianMutationChanged glutamine 67 to leucinePromoterCMVAvailable SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Rab8a-TN
Plasmid#86077PurposeA mammalian expression plasmid encoding GDP locked Rab8a (Rab8a-T22N) with N-terminus EGFP.DepositorInserthRab8A (RAB8A Human)
TagsGFPExpressionMammalianMutationChanged threonine 22 to asparginePromoterCMVAvailable SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmGFP-ADAR1-p150
Plasmid#117927PurposeADAR1-p150 expression plasmid.DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Cre
Plasmid#86805PurposeLentiviral vector that expresses an EGFP-Cre fusion protein with a nuclear localization signal from the CMV promoterDepositorInsertCre recombinase
UseCre/Lox and LentiviralTagsEGFP and nuclear localization signal: PKKKRKVExpressionMammalianPromoterCMVAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmGFP-ADAR1-p110
Plasmid#117928PurposeADAR1-p110 expression plasmid.DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CXCL12-sfGFP
Plasmid#98961PurposeMammalian expression plasmid for superfolder GFP-fused human chemokine CXCL12DepositorInsertCXCL12 (CXCL12 Human)
TagsSuperfolder GFPExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
SP6-VEE-GFP
Plasmid#58976Purposeexpression of GFP using a self-replicating Venezuelan equine encephalitis (VEE) virus RNA repliconDepositorInsertEGFP
UseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianPromoter26S subgenomic promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SV40.eGFP.SV40(polyA)
Plasmid#195558PurposeExpresses eGFP under control of short GFAP promoterDepositorInserteGFP
UseAAVTagsNo tagsExpressionMammalianPromotershort GFAPAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK3-2A-GFP
Plasmid#118286PurposeExpresses mouse DYRK3 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 (Dyrk3 Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Poly(A)
Plasmid#65524PurposePlasmid for the generation of gene disruptions via Bxb1-mediated recombination into MIN-tagged cell lines. This vector can also be used to express cDNAs.DepositorInsertattB-GFP
UseMouse Targeting; Bxb1ExpressionMammalianAvailable SinceAug. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK2-2A-GFP
Plasmid#118284PurposeExpresses mouse DYRK2 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 (Dyrk2 Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK4-2A-GFP
Plasmid#118288PurposeExpresses mouse DYRK4 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 (Dyrk4 Mouse)
UseAAVTags2A peptide and EGFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAT9651-BEAR-GFP
Plasmid#162989PurposeBEAR target plasmid with split EGFP and disrupted 5' splice siteDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLeAPS-GFP-blast
Plasmid#182230PurposeLentiviral transfer plasmid for the LeAPS packaging system; encodes GFP-P2A-blasticidin transgeneDepositorInsertGFP-P2A-Blasticidin
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV GG hUbV-EGFP
Plasmid#216161PurposeContains a Golden-Gate cloning cassette to express up to four gRNA and EGFPDepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-GFP-RPA70
Plasmid#164231Purposeretroviral plasmid for GFP-RPA70DepositorAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only