We narrowed to 4,733 results for: Gca
-
Viral Prep#169257-AAV1PurposeReady-to-use AAV1 particles produced from AAV-hSyn-Soma-jGCaMP8m (#169257). In addition to the viral particles, you will also receive purified AAV-hSyn-Soma-jGCaMP8m plasmid DNA. Syn-driven expression of soma-targeted calcium sensor jGCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-S5E2-GCaMP6f (AAV9)
Viral Prep#135632-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-S5E2-GCaMP6f (#135632). In addition to the viral particles, you will also receive purified pAAV-S5E2-GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the E2 regulatory element. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-GCaMP6F (AAV8)
Viral Prep#137122-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Con/Fon-GCaMP6F (#137122). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Con/Fon-GCaMP6F plasmid DNA. EF1a-driven, Cre and Flp-dependent expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Soma-jGCaMP8s (AAV1)
Viral Prep#169256-AAV1PurposeReady-to-use AAV1 particles produced from AAV-hSyn-Soma-jGCaMP8s (#169256). In addition to the viral particles, you will also receive purified AAV-hSyn-Soma-jGCaMP8s plasmid DNA. hSyn-driven expression of soma-targeted calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8m-WPRE (AAV Retrograde)
Viral Prep#162378-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-FLEX-jGCaMP8m-WPRE (#162378). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8m-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SomaGCaMP6f2 (AAV9)
Viral Prep#158757-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-SomaGCaMP6f2 (#158757). In addition to the viral particles, you will also receive purified pAAV-CAG-SomaGCaMP6f2 plasmid DNA. CAG-driven expression of soma-targeting GCaMP6f2. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAG promoterAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-GCaMP6M (AAV8)
Viral Prep#137121-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Coff/Fon-GCaMP6M (#137121). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Coff/Fon-GCaMP6M plasmid DNA. EF1a-driven expression of GCaMP6m in the presence of Flp recombinase (inhibited in the presence of Cre recombinase). These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-GCaMP6F (AAV8)
Viral Prep#137124-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Coff/Fon-GCaMP6F (#137124). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Coff/Fon-GCaMP6F plasmid DNA. EF1a-driven, Flp-dependent expression of GCaMP6f (inhibited in presence of Cre). These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA (AAV1)
Viral Prep#68717-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA (#68717). In addition to the viral particles, you will also receive purified pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA plasmid DNA. CAG-driven, Cre dependent, GCaMP6s calcium sensor and bicistronic, physically separate mRuby2 expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAG-FLEXTagsmRuby2 (Cre-dependent)Available SinceMay 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8f-WPRE (AAV Retrograde)
Viral Prep#162379-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-FLEX-jGCaMP8f-WPRE (#162379). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8f-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of the ultrafast calcium sensor, GCaMP8f. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (AAV1)
Viral Prep#104495-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (#104495). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE plasmid DNA. CAG-driven, Cre-dependent GCaMP7s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE (AAV1)
Viral Prep#162382-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE (#162382). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE plasmid DNA. CAG-driven, Cre-dependent expression of the ultrafast calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (AAV Retrograde)
Viral Prep#162377-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (#162377). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8s-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of calcium sensor GCaMP8s (more sensitive). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA (AAV1)
Viral Prep#68720-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA (#68720). In addition to the viral particles, you will also receive purified pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA plasmid DNA. Cre-dependent GCaMP6s calcium sensor and bicistronic, physically separate mRuby2 expression under a human synapsin1 promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterhSyn1-FLEXTagsmRuby2 (Cre-dependent)Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA3.1
Plasmid#64118PurposeVector for expression of St1 sgRNA3.1 in mammalian cellsDepositorInsertSt1 sgRNA3.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPEgRNA
Plasmid#172716PurposeDelivery of guide RNA for prime editingDepositorInsertgRNA
ExpressionBacterialAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST
Plasmid#125689PurposeC to T base editor for actinomycetesDepositorInsertstreptomyces codon optimized spCas9n (D10A), modified sgRNA casette, streptomyces codon optimized rAPOBEC1
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
1352wUV2 F2bbs kan GCANNNAGGk
Plasmid#18752DepositorInsert3 tandem zinc fingers
ExpressionBacterialMutationA Kan cassette (1090bp) is inserted between two b…Available SinceJuly 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJYS2_crtYf
Plasmid#85544PurposeConstitutive transcription of crRNA of crtYf, Spectinomycin resistanceDepositorInsertcrRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…ExpressionBacterialAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
CMV-GEX-GECO1
Plasmid#32443PurposeMammalian expression of green excitation ratiometric genetically encoded Ca2+ indicator for optical imagingDepositorInsertGEX-GECO1.0
ExpressionMammalianMutationGCaMP3 K69E/K119I/L173Q/T223S/F315L/F368L/L372Q/K…PromoterCMVAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
LZRS-IresGFP
Plasmid#21961DepositorInsertIres GFP
UseRetroviralExpressionMammalianMutationGACAGATGACTATGCAGAGATAvailable SinceSept. 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
scFLARE2
Plasmid#158700PurposeNeuronal expression of scFLARE2 componentDepositorInsertscFLARE2
UseAAVTagsHA, Flag, VP16ExpressionMammalianMutationTruncated form of TEV protease (220-242 amino aci…PromoterSynAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-8x-gRNA-eGFP
Plasmid#60718PurposeeGFP reporter containing 8 copies of a gRNA binding site for light-inducible dCas9 activationDepositorInsert8 copies of gRNA binding site (5'-AAAGGTCGAGAAACTGCAAA-3')
Available SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-shCntrl
Plasmid#69040PurposeLentiviral expression of control shRNADepositorInsertcontrol shRNA
UseLentiviral and RNAiExpressionMammalianPromoterU6Available SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Anillin
Plasmid#68027PurposeFull length Anillin rendered RNAi-resistant) in mammalian expression vector pEGFP-C1DepositorInsertAnillin (ANLN Human)
TagseGFPExpressionMammalianMutationsilent mutations at 798 5'-TGCC TCTTTGAATAAA…PromoterCMVAvailable SinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
alpha7nACHR_Nacho_GCAMP7s
Plasmid#182940Purposealpha7 nACHR expression in mammalian cell lines with calcium reporterDepositorAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
SS9_RNA
Plasmid#71656PurposeSS9-targeting gRNA for co-transformation with pSS9DepositorInsertSS9 gRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCgCas9_recT
Plasmid#153337PurposeDouble-plasmid-based CRISPR-Cas9 system in Corynebacterium glutamicum; pBL1ts oriVC. glutamicum; pSC101 oriVE. coli PlacM-SpCas9 Streptomyces coelicolor codon-optimized, Peftu-RecT; KanrDepositorInsertCas9
UseCRISPRExpressionBacterialAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only