We narrowed to 13,716 results for: sgRNA
-
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6a:sgRNA#2
Plasmid#64246Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSG4K5
Plasmid#74492PurposeFor cloning and constitutive expression of sgRNAs in E.coli. New sgRNAs are cloned into SapI sites and multiplex sgRNAs are cloned into BsaI sites. Kanamycin resistant with pSC101 origin of rep.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available sinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA
Plasmid#86613PurposeVector for tandem expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6c:sgRNA#4
Plasmid#64248Purposeexpresses sgRNA under U6c promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBluescriptSKII+ U6-sgRNA(F+E) empty
Plasmid#74707PurposeEncodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and BbsI sites that allow insertion of a spacer sequenceDepositorInsertU6 promoter driving sgRNA with Bbsi sites for insertion of spacer sequence
ExpressionMammalianAvailable sinceJuly 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorInsertSgRNA
UseCRISPRAvailable sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6d:sgRNA#5
Plasmid#64249Purposeexpresses sgRNA under U6d promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-AsCas12f1
Plasmid#171614PurposeAsCas12f1-based Human cell genome editingDepositorInsertAsCas12f1 and sgRNA_v1
ExpressionMammalianAvailable sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKCcas9dO
Plasmid#62552PurposeHigh efficiency Streptomyces genome editing by CRISPR/Cas9 systemDepositorInsertsScocas9
sgRNA ()
act-orf4 homology arm
UseCRISPR; Bacterial genome editingExpressionBacterialPromoterj23119 and ptipAAvailable sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJY-RpABE
Plasmid#112872Purposebinary vector for ABE expression in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA cassette
UseCRISPRExpressionPlantAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEJS614_pTetR-P2A-BFPnls/sgNS
Plasmid#108650PurposeNon-specific Spy sgRNA under U6 promoterDepositorInsertsNon-specific sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable sinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PLJR962
Plasmid#115162PurposeSth1 dCas9 TetR and KanR L5 Int attP for M. smegmatisDepositorInsertsSth1 sgRNA scaffold
Sth1 dCas9
TetR
L5 attP
L5 Int
KanR
UseUnspecifiedAvailable sinceSept. 14, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDonor_hU6
Plasmid#69312PurposesgRNA scaffold and human U6 promoterDepositorInserthU6 promoter and sgRNA scaffold flanked by BbsI sites
UseCRISPRPromoterhuman U6 promoterAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pL-CRISPR.EFS.GFP
Plasmid#57818PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGPromoterEFS and hU6Available sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgRNA 2 GAPDH
Plasmid#83809PurposeExpress Sg-2 sgRNA targeting GAPDHDepositorInsertSgRNA
UseCRISPRAvailable sinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-EN1201
Plasmid#92144PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse TIGRE acceptor locusDepositorInsertspCas9-nuclease and sgRNA against mouse TIGRE acceptor locus
ExpressionMammalianAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO5.sgRNA.EFS.PAC
Plasmid#57825PurposeLentiviral Vector for Sp sgRNA delivery without SpCas9, Puromycin resistance, EFS Promoter drivenDepositorInsertssgRNA
EFS
PAC
UseCRISPR and LentiviralAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by