We narrowed to 10,030 results for: Pol
-
Plasmid#49129PurposeAAV plasmid with DBH promoter (PRS2/3:Con) driving expression of iCre.DepositorInsertssAAV-PRS2/3:Con-iCre
UseAAVExpressionMammalianPromoterDBHAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-CMV-MCS-GFP-SV-puro
Plasmid#73582PurposeThird generation lentiviral vector expressing GFP and puromycinDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsGFP tagAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmScarlet-HSP70
Plasmid#163790PurposeExpresses mScarlet-Hsp70 in mammalian cellsDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
RDX-mCherry
Plasmid#214476PurposePlasmid for transient transfection of RDX-mCherry fusion protein in mammalian cells.DepositorInsertRDX (RDX Human)
TagsmCherryExpressionMammalianMutationSequence matches cDNA clone MGC:48283 IMAGE:52844…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQFlag-USP7 WT puroR
Plasmid#46751PurposeRetroviral vector that expresses wild type Flag-tagged human USP7DepositorAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pD21-hgAPOAI
Plasmid#124962PurposeExpress ApoAI in the liverDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CMV-mCherry-hPMCA2w/b
Plasmid#111570PurposeExpresses a plasma membrane calcium pump hPMCA2w/bDepositorAvailable SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET30a-His6-LOXCAT
Plasmid#140084PurposeFusion of A. viridans lactate oxidase (LOX) and E. coli catalase (CAT) that converts lactate into pyruvate without producing H2O2.DepositorInsertA fusion of lactate oxidase from A. viridans and catalase from E. coli
TagsHis6ExpressionBacterialPromoterT7Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYES2/103Q
Plasmid#1385DepositorInserthuntingtin (103Q) (HTT Human)
TagsEGFP and FLAGExpressionYeastMutationExon1 sequences containing the first 17 amino aci…Available SinceFeb. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTSlb-R756K
Plasmid#60731PurposeExpresses both fragments of T7 RNAP split at position 179. The N-terminal fragment is driven by PLac while the C-terminal fragment is driven by PBAD. C-terminal fragment has the point mutations R756SDepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available SinceNov. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTSara
Plasmid#60720PurposeExpresses both fragments of T7 RNAP split at position 179. Both fragments are driven by the arabinose inducible promoter PBAD. Also contains a constitutive araC ORFDepositorInsertsN Terminal fragment of T7 RNAP split betwen 179-180
N Terminal fragment of T7 RNAP split betwen 179-180
ExpressionBacterialMutationT7 RNAP split between positions 179-180 and wt T7…PromoterPBADAvailable SinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
PX458 V3
Plasmid#226957PurposeCBh-SpCas9-2A-GFP, and hU6-sgRNA (Sp) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pIRES-Puro-MGMT
Plasmid#187654PurposeExpresses hMGMT together with the puromycin resistance gene via an IRES.DepositorAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-H1-shScramble-hsynapsin-EGFP
Plasmid#220795Purposecontrol shRNA plasmid with EGFP expression in neuronsDepositorInsertEGFP
Available SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-H1-shSRGAP2B/C#2-hsynapsin-EGFP
Plasmid#220797PurposeshRNA plasmid against human SRGAP2B/C genes (#2) with EGFP expression in neuronsDepositorInsertEGFP
Available SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flag-Axin1
Plasmid#109370PurposeTransient over-expression of human Axin1DepositorAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-H1-shSRGAP2B/C#1-hsynapsin-EGFP
Plasmid#220796PurposeshRNA plasmid against human SRGAP2B/C genes (#1) with EGFP expression in neuronsDepositorInsertEGFP
Available SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRK5 Flag RagC(GD)/RagB(CTD) chimera
Plasmid#112774Purposeexpress Flag-RagC (G domain) fused with with RagB (C terminal domain)DepositorInsertFlag-RagC (G domain) fused with RagB (C terminal domain) (RRAGB Human)
TagsFlagExpressionMammalianAvailable SinceOct. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5 Flag RagB(GD)/RagC(CTD) chimera
Plasmid#112773Purposeexpress Flag-RagB (Gdomain) fused with RagC (C terminal domain)DepositorInsertFlag-RagB (G domain) fused with RagC (C terminal domain) (RRAGC Human)
TagsFlagExpressionMammalianAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2701-AGER-tdTomato
Plasmid#216470Purposedonor vector for targeting a tdTomato reporter to the human AGER locus at the endogenous ATG start siteDepositorInserttdTomato
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hGFAP-GFP
Plasmid#40592DepositorInsertGFP-S65T
UseMouse TargetingTagsMP-1 fragment (mouse protamine 1 intron and polya…ExpressionBacterial and MammalianMutationConstruct contains a mutated, humanized hGFP(S65T…PromoterhGFAP promoterAvailable SinceOct. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C-p50
Plasmid#180238PurposeExpresses p50 in mammalian cellsDepositorAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pN3-sTRAIL
Plasmid#154246PurposePlasmid compatible with non-viral delivery for secretion of trimeric human TRAILDepositorInsertSecretable Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand
ExpressionMammalianPromoterCMV PromoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIB-HIS-TEV-Cyclin-B
Plasmid#177012PurposeGenerate baculovirus for insect cell expression of Cyclin-B with N-terminal Polyhistidine-TEVDepositorInsertCyclin B1 (CCNB1 Human)
TagsPolyhistidine-TEVExpressionInsectMutationcodon-optimised for insect cell expressionAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP5F1B-turboGFP
Plasmid#239795PurposeExpresses human ATP5F1B tagged with turboGFPDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET30a-His6-LOXCATmut
Plasmid#140085PurposeA control for His6-LOXCAT where LOX is catalytically dead (mutations H265A and R268A)DepositorInsertA fusion of lactate oxidase from A. viridans and catalase from E. coli
TagsHis6ExpressionBacterialMutationMutation in H265A and R268A in LOX (used original…PromoterT7Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
px458-Cas9 UPF1 sgRNA
Plasmid#251491PurposeCas9 CRISPR gRNA construct; expresses human UPF1 gRNADepositorInsertUPF1 gRNA
ExpressionBacterialAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
LLP339 pGK-dCas9-SunTag
Plasmid#100943PurposedCas9 vector with SunTagx10, driven by pGK, with 3xHA tag, Puro driven by EF1aDepositorInsertdCas9, SunTag array (10xGCN4)
UseCRISPRTags3xHAExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSP64-mHCN2
Plasmid#53060PurposeExpresses alpha subunit of mouse HCN2 channel in Xenopus oocytesDepositorInsertPotassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2 (Hcn2 Mouse)
UseXenopus oocyte expressionMutationE55G, R237H, and K283R polymorphisms compared to …PromoterSP6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDFDuet-nsp7-nsp8
Plasmid#159092PurposeCoexpression construct of Nsp7 with an N-terminal His-tag and Nsp8DepositorInsertsNSP7
NSP8
TagsHisExpressionBacterialPromoterT7Available SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Src-Y530F
Plasmid#124659PurposeHuman c-Src with Y530F mutationDepositorAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
PDG458 V3
Plasmid#226959PurposeCBh-SpCas9-2A-GFP, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-HA
Plasmid#61355Purposeencodes c-terminal HA-tagged S. pyogenes dCas9 driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal HA tag
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P REV3L_1
Plasmid#160797PurposeSuppress REV3LDepositorInsertshREV3L_1
UseLentiviralAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P DNA2_2
Plasmid#160780PurposeSuppress DNA2DepositorInsertshDNA2_2
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P DNA2_1
Plasmid#160779PurposeSuppress DNA2DepositorInsertshDNA2_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4_10xUAS-CMVmin-BC0396-luc2
Plasmid#227115PurposeBarcoded assay, UAS sensor for split TEV assays; barcode BC0396DepositorInsert10x clustered UAS element linked to CMV minimal promoter driving barcode 0396 and a luciferase reporter gene
ExpressionMammalianAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cas9-NAT
Plasmid#64329PurposeCas9 expression cassette carried by a yeast single-copy episome plasmidDepositorInsertHuman-optimized S. pyogenes Cas9 with Clonnat marker gene expression cassette
UseCRISPRExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only