We narrowed to 11,638 results for: nar
-
Plasmid#226445PurposeFor subcloning of human EXOC3 promoter (base pairs -1592 to -1444) or for assays using M13 phageDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only
-
TOPO-EXOC3 (-1557 to-1444)
Plasmid#226447PurposeFor subcloning of human EXOC3 promoter (base pairs -1557 to-1444) or for assays using M13 phageDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8m-WPRE
Plasmid#162375PurposeAAV-mediated expression of ultrafast protein calcium sensor under the Syn promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV5, and AAV9InsertjGCaMP8m
UseAAVTags6xHisExpressionMammalianMutationA25G F286YPromoterSynapsinAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX MLKL(wt)--2A-mCherry-puro
Plasmid#231974PurposeTet inducible expression of DmrB-Mlkl with mCherry to induce WT Mlkl expressionDepositorAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-1(nsp8-nsp7)(nsp12)
Plasmid#165451PurposeExpresses the RNA Dependent RNA polymerase complex of SARS-CoV-2 in Escherichia ColiDepositorInsertsnsp12
nsp8
nsp7
Tags14Histidine-TEVExpressionBacterialPromoterT7Available SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1 GBP (GBP-mCherry)
Plasmid#162879PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with mCherryDepositorInsertGFP Binding Protein
TagsmCherryExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFB-His-SKP1
Plasmid#228368Purposeexpress human SKP1 in insect cells, such as Trichoplusia ni Hi5DepositorAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-26b-Nb127D01-HA-His
Plasmid#171566PurposeBacterial expression of HA-His-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-HA-His)DepositorInsertNb127D01-HA-His (CXCR2 Human)
TagsHA-tag/His-tag and PelB signal peptideExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-26b-NbVHH05-ALFA-His
Plasmid#171569PurposeBacterial expression of ALFA-His-tagged anti-UBC6e (human) recombinant alpaca nanobody (NbVHH05-ALFA-His)DepositorInsertNbVHH05-ALFA-His (UBE2J1 Human)
TagsALFA-tag/His-tag and PelB signal peptideExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCherry.90 alpha
Plasmid#108222PurposeMammalian expression vector for mCherry fusion to human Hsp90 alphaDepositorAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-sumo-NSP12 (SARS-CoV-2)
Plasmid#159107PurposeThe SARS-CoV-2 NSP12 coding sequence was cloned into a modified pRSFDuet-1 vector (Novagen) bearing an N-terminal His6-SUMO-tag which is cleavable by the ubiquitin-like protease (ULP1).DepositorInsertNSP12
TagsHis-SUMO tagExpressionBacterialMutationNonePromoterT7Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-gp32-H6
Plasmid#163912PurposeExpresses T4 gp32 for bacterial expression and affinity purificationDepositorInsertgp32
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CTCF-mAC donor (Hygro)
Plasmid#140646PurposeCTCF tagging with mAID-cloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8s-WPRE
Plasmid#162374PurposeAAV-mediated expression of ultrafast protein calcium sensor under the Syn promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV5, and AAV9InsertjGCaMP8s
UseAAVTags6xHisExpressionMammalianMutationS26M F286Y Q315HPromoterSynapsinAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
CTCF-mAC donor (Neo)
Plasmid#140645PurposeCTCF tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_POU2F2_WT
Plasmid#81873PurposeGateway Donor vector containing POU2F2 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMK262 (RAD21-mAC Neo)
Plasmid#140538PurposeRAD21 tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-EGFP-WPRE
Plasmid#51502PurposeCan be used to generate AAV virus that will express EGFP in the presence of CreDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEGFP
UseAAVPromoterCAGAvailable SinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVtet2_bGHpA
Plasmid#177352PurposeAAV expression of scFV-fused catalytic domain of TET2 for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…PromoterCMV promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-FBXO22
Plasmid#232271PurposeExpression of N-terminal tagged HA-FBXO22 (H. sapiens) in human cell linesDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC-G418-YR
Plasmid#61767PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing nptII (neomycin phosphotransferase II) selectable marker on transfer DNA (TDNA).DepositorInsertsnptII gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…PromotertrpC promoterAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a-uvsX-H6
Plasmid#163913PurposeExpresses uvsX for bacterial expression and affinity purificationDepositorInsertuvsX
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_TRAF5_WT
Plasmid#82167PurposeGateway Donor vector containing TRAF5 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
ZMYND8-dTAG
Plasmid#190617PurposeLentiviral expression plasmid of human ZMYND8 fused with FKBP12G36V for dTAG-mediated degradationDepositorInsertZMYND8 (ZMYND8 Human)
UseLentiviralTagsFKBP12_G36V and Flag, 2xHAExpressionMammalianMutationsynonymous mutation for sgRNA resistance at aa214…Available SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-S2215Y
Plasmid#69013Purposeactivating MTOR mutationDepositorAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8f-WPRE
Plasmid#162376PurposeAAV-mediated expression of ultrafast protein calcium sensor under the Syn promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV5, and AAV9InsertjGCaMP8f
UseAAVTags6xHisExpressionMammalianMutationQ315LPromoterSynapsinAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Jaws-KGC-GFP-ER2
Plasmid#65015PurposeAAV-mediated expression of Jaws under the CaMKII promoterDepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterCaMKIIAvailable SinceJune 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-BACH1
Plasmid#232269PurposeExpression of N-terminal tagged HA-BACH1 (H. sapiens) in human cell lines.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 FLAG-BACH2
Plasmid#232275PurposeExpression of FLAG-tagged BACH2 (H. sapiens) in human cell linesDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAJE3-E7
Plasmid#214359PurposeExpresses the 2nd-generation "E7" Tet2 Methanocaldococcus jannaschii (Mj) aminoacyl tRNA synthetase/tRNA pair for encoding Tet2 noncanonical amino acids into TAG sites of proteinsDepositorInserts2nd generation Tet2 "E7" aminoacyl tRNA synthetase
Lpp promoted M. jannaschii tRNA
Aminoglycoside-3''-adenyltransferase (Spectinomycin/streptomycin Resistance Gene)
Orthogonal "D4II" ColE1 origin
ExpressionBacterialPromoterAmpR and lppAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a 6xHis PreScission SARS-CoV-2 nsp13
Plasmid#159390PurposeExpresses the SARS-CoV-2 nsp13 protein with an N-terminal His6 tag followed by an HRV 3C/PreScission cleavage site.DepositorInsertN-terminal His tag PreScission SARS-CoV-2 nsp13, optimized for insect cell expression
TagsHis6 tagExpressionBacterialPromoterT7Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-L1460P
Plasmid#69006Purposeactivating MTOR mutationDepositorInsertMTOR-L1460P (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Leucine 1460 to ProlineAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
MYC-PGK-blast
Plasmid#190618PurposeLentiviral expression plasmid of human MYC, blast selectionDepositorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 (-) hYAP 1-1gamma
Plasmid#124141PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RNF138_pLX307
Plasmid#98368PurposeLentiviral expression of RNF138DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EF1a-Zim3-dCas9-loxP-P2A-EGFP-loxP
Plasmid#188773PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterEF1aAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-E1799K
Plasmid#69009Purposeactivating MTOR mutationDepositorInsertMTOR-E1799K (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Glutamate 1799 to LysineAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FBXL17
Plasmid#236188PurposeExpression of N-terminal tagged FLAG-FBXL17 (H. sapiens, codon-optimized) in human cell lines.DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-R2505P
Plasmid#69015Purposeactivating MTOR mutationDepositorInsertMTOR-R2505P (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Arginine 2505 to ProlineAvailable SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-T/O-Ds1-mCherry
Plasmid#112855PurposeDox inducible expression in mammalian cells of Ds1 protein fused to mCherry fluorescent proteinDepositorInsertDCHS1 (DCHS1 Human)
TagsmCherryExpressionMammalianPromoterdoxycycline inducible promoterAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR2
Plasmid#167001PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR3
Plasmid#167002PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-F1888L
Plasmid#69010Purposeactivating MTOR mutationDepositorInsertMTOR-F1888L (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Phenylalanine 1888 to LeucineAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hGPR56-IRES-GFP
Plasmid#52297PurposeExpresses human GPR56 and GFP in mammalian cells.DepositorAvailable SinceApril 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR10
Plasmid#167003PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
anti-GFP scFv [N86/38] with sortase tag
Plasmid#204419PurposeMammalian Expression of anti-GFP scFv with a sortase tag for direct dye conjugation. Derived from hybridoma N86/38.DepositorInsertRecombinant mouse scFv targeting GFP (Aequorea victoria)
Tags6xHis tag and Sortase tagExpressionMammalianAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-I2500F
Plasmid#69014Purposeactivating MTOR mutationDepositorInsertMTOR-I2500F (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Isoleucine 2500 to PhenylalanineAvailable SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iFlpV
Plasmid#140137Purposecan be used to generate AAV virus that will express light-inducible site-specific iFlpV recombinaseDepositorHas ServiceAAV PHP.eB and AAV1InsertiFlpV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only