We narrowed to 3,415 results for: cmv promoter
-
Plasmid#134332PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA16_Lmo with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA16_Lmo
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIC1-NLS(SV40) (KAC208)
Plasmid#134340PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIC1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIC1
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA17_Efa-NLS(SV40) (KAC91)
Plasmid#134333PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA17_Efa with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA17_Efa
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA17_Sga-NLS(SV40) (KAC92)
Plasmid#134334PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA17_Sga with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA17_Sga
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA18_Sma-NLS(SV40) (KAC95)
Plasmid#134335PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA18_Sma with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA18_Sma
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA19_Ssim-NLS(SV40) (KAC97)
Plasmid#134336PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA19_Ssim with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA19_Ssim
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA18_Sga-NLS(SV40) (KAC214)
Plasmid#134338PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA18_Sga with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA18_Sga
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA19_Spse-NLS(SV40) (KAC215)
Plasmid#134339PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA19_Spse with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA19_Spse
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1-NLS(SV40) (KAC478)
Plasmid#133795PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKG2438_pGEEC534_pShip-CMV-mRuby2-P2A-PuroR-bGH
Plasmid#239730PurposePlasmid expressing mRuby2 and PuroR with the CMV promoterDepositorInsertmRuby2-P2A-PuroR
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJB002 CMV 3xFLAG-NLS-DsDed-ZF1
Plasmid#161532PurposeConstitutive expression ofCMV 3xFLAG-NLS-DsDed-ZF1 under the CMV promoterDepositorInsert3xFLAG-NLS-DsDed-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD6-Puro
Plasmid#239953PurposeLentiviral vector to generate MFSD6 stable expressing cell line under CMV promoterDepositorInsertMFSD6
UseLentiviralTagsmyc-flagExpressionMammalianAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-V5-RFP-LATS1
Plasmid#235689PurposeExpress RFP tagged LATS1 gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST p38KTRmCerulean3
Plasmid#59155PurposeLentiviral vector to express p38 KTR mCerulean3 under CMV promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Mouse, Human)
UseLentiviralTagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD8-Puro
Plasmid#239954PurposeLentiviral vector to generate MFSD8 stable expressing cell line under CMV promoterDepositorInsertMFSD8
UseLentiviralTagsmyc-flagExpressionMammalianAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-IgK-pHluorin-TM-mRuby
Plasmid#185546PurposeExpresses surface-localized pHluorin fused to intracellular expression of mRuby under CMV promoterDepositorInsertIgK-pHluorin-TM-mRuby
ExpressionMammalianPromoterCMVAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CMV-Cas9-P2A-HygR
Plasmid#164133PurposeLentiviral construct for the expression of SpCas9 driven by CMV promoter in mammalian cellsDepositorAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-NFIB-T2A-miRFP670
Plasmid#187222PurposeExpresses human NFIB and miRFP670 via T2A linker under control of a CMV promoter.DepositorInsertNuclear Factor I B (NFIB Human)
TagsInserted T2A-miRFP670 at 3' terminal of MCS.ExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV superYFP-AURKA-mTurq2
Plasmid#157772PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowG-AURKA-mTurq2
Plasmid#157768PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV-hCas9 R4-R3
Plasmid#62132PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing CMV promoter and human codon optimized Cas9 module Compatible with MultiSite Gateway cloningDepositorInserthuman codon optimized Cas9
UseCRISPR; Mule gateway entry vectorExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV/TO-miR-30 L1-R5
Plasmid#62122PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a tet-inducible CMV promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV/TO-miR-30 L5-L2
Plasmid#62123PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a tet-inducible CMV promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV/TO-miR-30 L1-L4
Plasmid#62124PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a tet-inducible CMV promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV/TO-miR-30 R4-R3
Plasmid#62125PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a tet-inducible CMV promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV/TO-miR-30 L5-L4
Plasmid#62126PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a tet-inducible CMV promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-PTPN14-CFP
Plasmid#235686PurposeExpress CFP tagged PTPN14 gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-FOXC1-T2A-miRFP670
Plasmid#182336PurposeExpresses human FOXC1 and miRFP670 via T2A linker under control of a CMV promoter.DepositorInsertForkhead Box C1 (FOXC1 Human)
TagsInserted T2A-miRFP670 at 3' terminal of MCS.ExpressionMammalianPromoterCMVAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-SOX2-T2A-miRFP670
Plasmid#187375PurposeExpresses human SOX2 and miRFP670 via T2A linker under control of a CMV promoter.DepositorAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 4 CMV eGFP
Plasmid#206272PurposeENTR Vector 4 for MultiSite Gateway assembly. Encodes eGFP under the control of a CMV promoterDepositorInserteGFP
UseMultimate/gateway entr 4ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 4 CMV mTagBFP
Plasmid#206279PurposeENTR Vector 4 for MultiSite Gateway assembly. Encodes mTagBFP under the control of a CMV promoter.DepositorInsertmTagBFP
UseMultimate/gateway entr 4ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowY-AURKA-mTurq2
Plasmid#157770PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1122 CMV 3xFLAG-NES-PYL1-VP64 in TUPV3
Plasmid#161547PurposeConstitutive expression of 3xFLAG-NES-PYL1-VP64 under the CMV promoterDepositorInsert3xFLAG-NES-PYL1-VP64
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAV-CMVp-2xTetO-Tornado-1xALFATag-5xSunTag_codon_optimized-4x(6xAAA)
Plasmid#231603PurposeExpress circular RNA translation reporter with 1xALFATag-5xSunTag_codon_optimized-4x(6xAAA) under CMV promoterDepositorInsertTornado-1xALFATag-5xSunTag_codon_optimized-4x(6xAAA)
ExpressionMammalianAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAV-CMVp-2xTetO-Tornado-1xALFATag-5xSunTag_codon_optimized+8xAAA
Plasmid#231604PurposeExpress circular RNA translation reporter with 1xALFATag-5xSunTag_codon_optimized-8xAAA under CMV promoterDepositorInsertTornado-1xALFATag-5xSunTag_codon_optimized-8xAAA
ExpressionMammalianAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A10.T)
Viral Prep#157970-AAV.A10.TPurposeReady-to-use AAV6(dbY-F+T-V) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A08.T)
Viral Prep#157970-AAV.A08.TPurposeReady-to-use AAV2(4pMut)dHS in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
LiOn-CMV∞Cre
Plasmid#154018PurposeVector based on the LiOn integration-coupled translational switch (Kumamoto et al bioRxiv 2019) expressing a functional Cre recombinase from a CMV promoter upon action of the piggyBac transposaseDepositorInsertCre-FLAG
ExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMVc-Cas9
Plasmid#106431PurposeExpresses SpCas9 from the CMVc promoter in AAV backboneDepositorInsertCas9
UseAAV and CRISPRTagsHA-NLS and NLSExpressionMammalianPromoterCMVcAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-2NLS-Cas9
Plasmid#229773PurposeExpresses Cas9 driven by a CMV promoterDepositorInsertSpCas9
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC590 - pCMV ER-iRFP
Plasmid#59136PurposeA plasmid that express endoplasmic reticulum-targeted iRFP under the CMV promoter.DepositorInsertER-localized Infrared Fluorescent Protein
TagsER retention signal and signal peptideExpressionMammalianPromoterCMV-IEAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pR26-CMVconst-mBMP7
Plasmid#127375PurposeAllows for constitutive BMP7 expression from the murine ROSA26 safe harbor locus upon CRISPR/Cas9-mediated genomic insertion and stable selection.DepositorAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOS001: CMV-Optopatch2_FCK
Plasmid#62984PurposeCoexpression plasmid of QuasAr2 and CheRiff for all-optical electrophysiology under CMV promoterDepositorInsertOptopatch2
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVtet1_bGHpA
Plasmid#177351PurposeAAV expression of scFV-fused catalytic domain of TET1 for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationN terminal domain of human Tet1PromoterCMV promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mTDGa.1-BioID2-HA
Plasmid#232028Purposemammalian expression (CMV promoter) of murine TDGa.1 (catalytic mutant N151A) fused to BioID2-HADepositorInsertTdg (Tdg Mouse)
TagsBioID2-HAExpressionMammalianMutationN151A (site-directed mutagenesis: aac -> gcc)PromoterCMVAvailable SinceNov. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMuLE_EXPR_CMV-eGFP_TOP-NLuc1.1_12GLI-FLuc_CBF-GLuc
Plasmid#113862PurposeTriple pathway reporter, 3P-Luc; wnt-NLuc1.1, hedgehog-FLuc, notch-GLuc; plus CMV-eGFP. Gateway expression vector for lentivirus generation.DepositorInsertsCMV-eGFP
TOP-NLuc1.1
12GLI-Fluc
CBF-GLuc
UseLentiviralExpressionMammalianAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDsRed1-CMV-Rat Arc-DsRed1-pA
Plasmid#233049PurposeTo Express a Rat Arc-DsRed fusion protein from a CMV promoterDepositorAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMJA285= pSin-TCRab-CMVp-Puro
Plasmid#116875Purposestable TCR expression in human T cellsDepositorUseLentiviralExpressionMammalianMutationdeletion of EF1-a promotorPromoterCMV PromotorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RRL.sin.cPPT.CMV/Flag-E2-crimson.IRES-puro.WPRE (MT06)
Plasmid#139448PurposeLentiviral vector to ectopically express Flag-tagged E2-crimson from CMV promoterDepositorInsertFLAG-tag E2-crimson
UseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only