We narrowed to 15,163 results for: GRN
-
Plasmid#106160PurposeEasyCloneYALI system-based yeast gRNA expression vector carrying a nourseothricin-resistance marker, helps to integrate vector pCfB6371 into Yarrowia lipolytica chromosomal location IntC_3, amp resistanceDepositorInsertunknown
ExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMK
Plasmid#62818PurposeBacterial constitutive S. pyogenes Cas9 expression plasmidDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSN007
Plasmid#102440PurposeFor PCR amplification to create paired gRNAs to clone into Golden Gate gRNA expression vectors (e.g. pSB700 Plasmid #64046)DepositorInsert7SK paired gRNA insert
UseSynthetic BiologyExpressionBacterialAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJG380
Plasmid#91188PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, nuclease (AtCas9+gNt_R2+donor)DepositorInsertAtCas9+gNt_R2+donor
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
mZO1-1 shRNA
Plasmid#37215DepositorAvailable SinceSept. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Tail-8A8G
Plasmid#157981PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Tail-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196080Purpose(Empty Backbone) Inducible CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Blasticidin S deaminase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIF4
Plasmid#196069PurposeExpresses dCas9-Mxi1 with MoRP27 promoter and express gRNA with MoU6 promtoer in M. oryzaeDepositorInsertdCas9-Mxi1
UseCRISPRPromoterMoRP27 promoterAvailable SinceApril 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIF3
Plasmid#196068PurposeExpresses dCas9-Mxi1 with MoRP27 promoter and express gRNA with MoU3 promtoer in M. oryzaeDepositorInsertdCas9-Mxi1
UseCRISPRPromoterMoRP27 promoterAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
GWF297
Plasmid#133612PurposeTET3G-2xMS2(wt+f6), NLS-MCP-ANR-ANR-P2a-BFPDepositorInsertTET3G-2xMS2(wt+f6), MCP-ANR-ANR, BFP
ExpressionMammalianAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWT046a
Plasmid#107897PurposeW2.2, W2.4-1 plasmid. Contains PTetO-SD8-BE2, PBAD-sgRNA3 and is part of CAMERA 2.2 and 2.4DepositorInsertPTetO-SD8-BE2, PBAD-sgRNA3
ExpressionBacterialAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
EC70197
Plasmid#209458PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterTaU3Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC70196
Plasmid#209457PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterTaU3Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC70207
Plasmid#209468PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterTaU6Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC70191
Plasmid#209452PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterHvU3Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC70195
Plasmid#209456PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterTaU3Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_EPHA2
Plasmid#183286PurposeAll-in-One CRISPRko system with a guide RNA that targets EPHA2 geneDepositorInsertEPHA2
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ERBB2
Plasmid#183287PurposeAll-in-One CRISPRko system with a guide RNA that targets ERBB2 geneDepositorInsertERBB2
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGC48
Plasmid#19679DepositorInsertGateway(R2-R1)-L4440
UseGateway Cloning and RNAiAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
LRG-2.1T-neo-sgROSA
Plasmid#105587Purposelentivirally express gRNA targeting ROSA26 locus with GFP marker and neo resistanceDepositorInsertgRNA targeting rosa26 locus
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shControl
Plasmid#180386PurposeProducing AAV that encodes negative control shRNA with miR-E backboneDepositorInsertshControl
UseAAV and RNAiPromoterCBAAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJG488
Plasmid#91196PurposeWDV replicon T-DNA for gene targeting in wheat scutella, H840A double nickase (nTaCas9_H840A+gUbi8+gUbi1+donor)DepositorInsertnTaCas9_H840A+gUbi8+gUbi1+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2517
Plasmid#91074PurposeModule B, Promoter: TaU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterTaU3Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-24xMS2
Plasmid#212629PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-24xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-4xMS2
Plasmid#212626PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-4xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPv2_AAVS1
Plasmid#184487PurposeLentivirus all in one CRISPR vector targeting human AAVS1 geneDepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LRT2B-GO2
Plasmid#136909PurposeLentivirus expressing GO2 sgRNADepositorInsertsgGO2
UseLentiviralMutationWTPromoterhU6Available SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKT-H3.3-K27M-katushka
Plasmid#209443PurposeSB-transposable plasmid expressing a mutant histone H3.3-K27M in tandem with Katushka (RFP)DepositorInsertH3.3-K27M
ExpressionMammalianMutationK27MAvailable SinceJan. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
GluA3 (px330:2-guideCas9)
Plasmid#169424PurposeExpression of Cas9 and 2 guidesDepositorInsertspCas9
UseCRISPRExpressionMammalianAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-GFP-miRE_shRen-Blast
Plasmid#135682PurposeConstitutive expression (EF1a promoter) of GFP cDNA plus miRE-embedded shRenilla (control shRNA), Blasticidin selectionDepositorInsertshRenilla
UseLentiviralAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2121
Plasmid#91065PurposeModule B, Promoter: GmUbi, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterGmUbiAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAGC-Lb12-P1Bb
Plasmid#231387PurposeFor crRNA cloning with LbCas12a vectors for genome editing in ArabidopsisDepositorInsertU6-29
UseCRISPRExpressionPlantAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v2 sgATG7
Plasmid#211534PurposeDeletes ATG7DepositorInsertsgATG7
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458-AAVS1-sg
Plasmid#194721Purposepx458 with guide RNA that target hAAVS1DepositorAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDrop
Plasmid#184872PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for in-vivo excision of transferred DNA for homologous recombination and counter-selection for successful integration.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Lenti-BaeI-Pgk-Cre
Plasmid#173663PurposeVector with BaeI site to allow cloning of custom sgRNA into vector containing Cre-recombinaseDepositorInsertBaeI site
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#1
Plasmid#174152PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
BII-gR-PnTW
Plasmid#133356PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications) coexpressed with tdTomato-NLSDepositorInserttdTomato-NLS
TagsHA-tagged tdTomatoExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH102
Plasmid#128207PurposesgRNA backbone for SaCas9, combine with AtU6-26 promoter module (pFH35)DepositorInsertsgRNA backbone for SaCas9, combine with AtU6-26 promoter module (pFH35)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-crRNA(Non-targeting)
Plasmid#109324PurposeAAV vector expressing non-targeting AsCpf1 crRNADepositorInsertmCherry-KASH
UseAAVPromoterhSyn1Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
ZO-2 shRNA 1609
Plasmid#37209DepositorAvailable SinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-Luc-A
Plasmid#25756PurposeEntry vector with human U6 promoter driving control Luciferase miR30-based shRNA.DepositorInsertLuciferase miR-shRNA
UseGateway CloningAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
PX458 eSp(1.1) V3
Plasmid#226963PurposeCBh-eSpCas9(1.1)-2A-GFP, and hU6-sgRNA (Sp) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-H1-shScramble-hsynapsin-EGFP
Plasmid#220795Purposecontrol shRNA plasmid with EGFP expression in neuronsDepositorInsertEGFP
Available SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2516
Plasmid#91084PurposeModule C, Promoter: At7SL, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterAt7SLAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-ARF1a
Plasmid#67493PurposeExpression of shRNA targeting human ARF1aDepositorInsertHsARF1 shRNA
UseRNAiExpressionMammalianPromoterH1Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD2_3
Plasmid#36370DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAbaMCi-GFP-BsaI_pJMP2748
Plasmid#208888PurposeAcinetobacter baumannii CRISPRi test plasmid (GFP, BsaI cloning site in gRNA cassette).DepositorInsertdCas9, sgRNA expression cassette, sfGFP
UsePir dependent origin of replicationExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYap1-1
Plasmid#193669PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only