-
Plasmid#159790PurposeS. pyogenes sgRNA collocated with pegRNA targeting human VEGFA geneDepositorInsertspacer of sgRNA targeting VEGFA gene (VEGFA Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_rActb sgRNA / hSpCas9
Plasmid#172833PurposeMammalian expression of a sgRNA targeting the intron 1of rat Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of rActb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_Tuba1b sgRNA / hSpCas9
Plasmid#172835PurposeMammalian expression of a sgRNA targeting the intron 1 of Tuba1b (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Tuba1b under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA with rpr-1 promoter
Plasmid#48961Purposeto drive the sgRNA expression under RNase P non-coding RNA promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionWormMutationPromoterrpr-1 promoterAvailable sinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330_rSyn1 sgRNA / hSpCas9
Plasmid#172840PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of rSyn1 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of rSyn1 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-RPL26 sgRNA2
Plasmid#134642Purposecontains sgRNA targeting to the C-terminus of human RPL26 for gene editingDepositorInsertRPL26 sgRNA2 (RPL26 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-RPL26 sgRNA1
Plasmid#134641Purposecontains sgRNA targeting to the C-terminus of human RPL26 for gene editingDepositorInsertRPL26 sgRNA2 (RPL26 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 R2842C
Plasmid#139324PurposePlasmid expressing a sgRNA to introduce BRCA2 R2842C using base editingDepositorInsertsgRNA to insert BRCA2 R2842C using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFREE2-eSpCas9-sgRNA
Plasmid#179580PurposeExpresses eSpCas9 and gRNA that targets ColE1 plasmids for curingDepositorInserteSpCas9
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-CNPsgRNA
Plasmid#126610PurposeExpresses CNP sgRNA under mouse U6 promoterDepositorInsertCNP sgRNA (Cnp Mouse)
UseCRISPRTagsExpressionMutationPromotermouse U6 promoterAvailable sinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
Human T (BRACHYURY) sgRNA
Plasmid#59726PurposePlasmid encoding sgRNA to generate T (BRACHYURY) knock-out mutant human cellsDepositorInserthT sgRNA (TBXT Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330_CALR sgRNA / hSpCas9
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_sgRNA
Plasmid#68422PurposeTransient expression of a minimal sgRNA targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertGluc sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterhuman U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 kif26b sgRNA1
Plasmid#102857PurposeExpresses sgRNA targeting mouse Kif26bDepositorInsertMouse Kif26b (Kif26b Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 kif26b sgRNA2
Plasmid#102858PurposeExpresses sgRNA targeting mouse Kif26bDepositorInsertMouse Kif26b (Kif26b Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330-UFSP2 sgRNA1
Plasmid#134638Purposecontains sgRNA targeting human UFSP2 for gene knockoutDepositorInsertUFSP2 sgRNA1 (UFSP2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_EMX1-mcherry
Plasmid#159784PurposeS. pyogenes sgRNA collocated with pegRNA targeting human EMX1 geneDepositorInsertspacer of sgRNA targeting EMX1gene (EMX1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_HOXD13-mcherry
Plasmid#159793PurposeS. pyogenes sgRNA collocated with pegRNA targeting mouse HOXD13 geneDepositorInsertspacer of sgRNA targeting HOXD13 gene (HOXD13 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
Human SOX17 sgRNA
Plasmid#59725PurposePlasmid encoding sgRNA to generate SOX17 knock-out mutant human cellsDepositorInserthSox17 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
Human BLIMP1 sgRNA
Plasmid#59724PurposePlasmid encoding sgRNA to generate BLIMP1 knockout mutant human cellsDepositorInserthBLIMP1 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
px459-Rheb sgRNA
Plasmid#133768PurposeExpresses Cas9 and human Rheb sgRNADepositorInsertRheb sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C3orf17 sgRNA 1
Plasmid#70652PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C3orf17 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C3orf17
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 1
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 2
Plasmid#70654PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-H1-sgRNA-hTZAP
Plasmid#87186PurposeguideRNA targeting exon1 of human TZAPDepositorInsertTZAP (ZBTB48 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterH1Available sinceMarch 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-sgRNA-BFP-Puro
Plasmid#229013PurposePerturb Seq sgRNA vector with PiggyBac backboneDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT6)
Plasmid#236203Purposelentiviral expression of Cas9 and encodes CT6 sgRNA for CLEC12A deletionDepositorInsertClec12a (Clec12a Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT44)
Plasmid#236204Purposelentiviral expression of Cas9 and encodes CT44 sgRNA for CLEC12A deletionDepositorInsertClec12a (Clec12a Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT47)
Plasmid#236205Purposelentiviral expression of Cas9 and encodes CT47 sgRNA for CLEC12A deletionDepositorInsertClec12a (Clec12a Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
UseTagsNoneExpressionMammalianMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458-eBFP2-sgRNA_CTCF_ZF1
Plasmid#233090PurposeExpression vector for a sgRNA against the mouse CTCF ZF1 region and SpCas9-T2A-eBFP2.DepositorInsertspCas9-T2A-eBFP2 (Ctcf )
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CRISPRi-sgRNA
Plasmid#221135PurposeHelper plasmid for sgRNA cloning for CRISPRi. sgRNA-scaffold with dCas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with dCas9 handle
UseCRISPRTagsExpressionBacterialMutationPromoterJ23119(SpeI)Available sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbVPE1a/b
Plasmid#223218PurposeExpresses an sgRNA targeting the NbVPE1a/b genes in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbVPE1a/b
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantMutationPromoterArabidopsis U6 promoterAvailable sinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbCysP6
Plasmid#223217PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbCysP6 sgRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantMutationPromoterArabidopsis U6 promoterAvailable sinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd
Plasmid#216170PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPExpressionMutationPromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.PRDM1-ZEB2_CRISPRd
Plasmid#216171PurposeExpress the gRNA targeting the PRDM1-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- PRDM1.bs- ZEB2.locus (PRDM1 Human)
UseLentiviralTagsEGFPExpressionMutationPromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
Plasmid#216172PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- Control- ZEB2.locus
UseLentiviralTagsEGFPExpressionMutationPromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only