We narrowed to 11,797 results for: ada
-
Plasmid#187483PurposeExpression vector - ACE2DepositorAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only
-
LentiCRISPR v2-sgAMPK alpha2 clone1
Plasmid#162122PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_POLD2-APOBEC1-UdgX-NG-nCas9-UdgX
Plasmid#163545PurposeMammalian CG-to-GC base editingDepositorInsertPOLD2-APOBEC1-UdgX-NG-nCas9-UdgX
UseCRISPRExpressionMammalianMutationnCas9 (D10A)NG (L111R, D1135V, G1218R, E1219F, A1…Available SinceDec. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSET-XS-VWF
Plasmid#64847PurposeExpresses aa1594–1670 of VWF A2 domain flanked by Venus and Cerulean and tagged with 7X His at C terminusDepositorInsertVenus_VWF A2 domain aa 1594-1670_Cerulean_TEV_7X His (VWF Synthetic, Human)
Tags7X His, Cerulean, and VenusExpressionBacterialPromoterT7Available SinceMay 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
NC15 pGLUE CUL3
Plasmid#36970DepositorAvailable SinceJuly 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
Raichu-OsRac1 CA
Plasmid#133264PurposeConstitutively-active (CA) mutant of OsRac1; Acts as a positive control for small GTPases activation assays.DepositorInsertOsRac1(G19V) (LOC4325879 Oryza sativa)
TagsCFP-lipid and Venus-CRIBExpressionPlantMutationOsRac1 G19VPromoterUbiAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
Raichu-OsRac1 DN
Plasmid#133263PurposeDominant-negative (DN) mutant of OsRac1; Acts as a negative control for small GTPases activation assaysDepositorInsertOsRac1(T24N) (LOC4325879 Oryza sativa)
TagsCFP-lipid and Venus-CRIBExpressionPlantMutationOsRac1 T24NPromoterUbiAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKK-mEGFP-TEV
Plasmid#105777PurposeExpression of your protein of interest in fusion with green fluorescent protein at the N-terminus (cleavable by TEV). mEGFP is an EGFP A206K mutant with reduced dimerization (PMID: 11988576,22869113).DepositorTypeEmpty backboneUseFlp-in competentTagsmEGFP-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-TSC22D3
Plasmid#192916PurposeBarcoded piggybac transposon vector with Dox-inducible expression of TSC22D3DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry-N1-iChloC_CA
Plasmid#98171Purposeslow cycling (open for minutes) step-function artificial anion conducting channelrhodopsin (aACR). High light sensitivity. Activation with blue to green light, inactivation max with 605 nm (accelarates closure to ms). Codon optimized for mammalian expression.DepositorInsertSynthetic construct iChloC_C128A gene
TagsmCherryExpressionMammalianMutationE83Q, E90R, E101S, C128A, T159C, D156NPromoterCMV (+enhancer)Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT2-CMV/TetO2-EYFP-GW
Plasmid#153309PurposeTet-On YFP-tagged Gateway destination vector, to be used together with pT2-TetR-neoR transposon plasmidDepositorTypeEmpty backboneUseTransposonTagsYellow Fluorescent ProteinAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYpet-Optop38i
Plasmid#89749PurposeExpression of light-regulated p38 inhibitor, Ypet-fused, wild-type photosensor, inhibitor MK3BD3-13FDepositorInsertOptop38i3
UseFluorescent proteinTagsYpetExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_NPYmut
Plasmid#208678PurposeExpresses the genetically-encoded fluorescent neuropeptide Y (NPY) control sensor GRAB_NPYmut in mammalian cellsDepositorInsertGPCR activation based neuropeptide Y (NPY) control sensor GRAB_NPYmut
ExpressionMammalianPromoterCMVAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pR26-mBMP7
Plasmid#127374PurposeAllows for doxycycline-inducible BMP7 expression from the murine ROSA26 safe harbor locus upon CRISPR/Cas9-mediated genomic insertion and stable selection.DepositorInsertBMP7 (Bmp7 Mouse)
UseCRISPR and Mouse TargetingAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTIGER_mNeonGreen::3xFLAG::dCrk
Plasmid#131137PurposeUASp construct for over-expression of Drosophila Crk with N-terminal monomeric NeonGreen and 3X FLAG tag. Compatible with PhiC31-mediated site-specific integration or classical P-element insertion.DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJM186A
Plasmid#218127PurposeHybrid circuit displaying hsCRBN bait and driving expression of gIIIDepositorInsertsTags434cI_RR69Available SinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ 2xFLAG-2xSTREP_BACH1_Y11F
Plasmid#159132PurposeExpresses BACH1 in mammalian cellsDepositorAvailable SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBullet-tgn-c
Plasmid#53072Purposedestination vector with ECFP-trans golgi network marker (VTI12) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_UCN1.0
Plasmid#208668PurposeExpresses the genetically-encoded fluorescent urocortin (UCN) sensor GRAB_UCN1.0 in neuronsDepositorInsertGPCR activation based urocortin (UCN) sensor GRAB_UCN1.0
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry-C1-Aurora
Plasmid#98167Purposered-shifted artificial anion conducting channelrhodopsin (aACR). Activation up to 600 nm; off-kinetics 260 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora gene
TagsmCherryExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, P242R, A24…PromoterCMV (+enhancer)Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry-C1-Phobos
Plasmid#98166Purposeblue-shifted artificial anion conducting channelrhodopsin (aACR). Activation max 466 nm; off-kinetics 10 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Phobos gene
TagsmCherryExpressionMammalianMutationT59S, E83N, E90Q, E101S, V117R, E123S, T159G, G16…PromoterCMV (+enhancer)Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmeIF4G-trunc-V5His6_G
Plasmid#146392PurposeInsect Expression of DmeIF4G-trunc. *Note: this plasmid does not contain an HA-tag as the name implies.DepositorInsertDmeIF4G-trunc (eIF4G1 Fly)
ExpressionInsectMutation322-1666 truncated version of elF4G sequence with…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NOPLight-ctr
Plasmid#195579PurposeExpresses the control sensor NOPLight-ctr in mammalian cellsDepositorInsertNOPLight-ctr
ExpressionMammalianMutationD110A, D130APromoterCMVAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBullet-end-c
Plasmid#53074Purposedestination vector with ECFP- endosome marker (RabF2a) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSynapsin1_NOPLight1
Plasmid#195580PurposeExpresses NOPLight1 in neuronsDepositorInsertNOPLight1
UseAAVExpressionMammalianPromoterhuman Synapsin-1Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAVA-Gal11p-LGF2(fs)
Plasmid#127482PurposeNegative control for the AVA-seq system. Gal11p (lambda CI associated) and LGF2 (with one nucleotide insertion) (RNAp associated) interactionDepositorInsertGal11p-LGF2(frame shifted) (GAL11 Budding Yeast)
ExpressionBacterialMutationLGF2 is frame shifted by the insert of one nucleo…Available SinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H3C2
Plasmid#207783PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a moxGFP-Puro Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hSyn-DIO-GRAB_CCK1.0
Plasmid#208674PurposeExpresses the genetically-encoded fluorescent cholecystokinin (CCK) sensor GRAB_CCK1.0 in a cre-dependent mannerDepositorInsertGPCR activation based cholecystokinin (CCK) sensor GRAB_CCK1.0
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NPYmut
Plasmid#208679PurposeExpresses the genetically-encoded fluorescent neuropeptide Y (NPY) control sensor GRAB_NPYmut in neuronsDepositorInsertGPCR activation based neuropeptide Y (NPY) control sensor GRAB_NPYmut
UseAAVPromoterhSynAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKK-NoTag
Plasmid#105767PurposeControl vector for pKK series (encodes only SLIC arms (TEV-L and TEV-R)); expression without tag. Useful to design other vectors; any tag can be added.DepositorTypeEmpty backboneUseFlp-in competentExpressionMammalianAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_mCh-SspB (pBS1144)
Plasmid#185326PurposeFor the mammalian expression of the human protein ApoE3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX307 DEDD
Plasmid#117744PurposeOpen reading frame vector encoding DEDDDepositorAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-APPL1-R146A/K152A/R154A
Plasmid#59767PurposeExpresses APPL1 Endosomal Localization MutantDepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCold I-Hero13
Plasmid#187929PurposeBacterial expression of heat-resistant obscure (Hero) protein Hero13DepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTIGER_tdTomato::3xFLAG::dCrk
Plasmid#131138PurposeUASp construct for over-expression of Drosophila Crk with N-terminal tandem Tomato and 3X FLAG tag. Compatible with PhiC31-mediated site-specific integration or classical P-element insertion.DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-T0-Flag-HROB
Plasmid#135298PurposeExpresses Flag-tagged HROB in mammalian cellsDepositorAvailable SinceMarch 2, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHAGE2-TetOminiCMV-Klf4
Plasmid#136613PurposeDox-inducible lentiviral vector expressing mouse Klf4DepositorAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TGt
Plasmid#44508DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKK-FLAG-TEV
Plasmid#105768PurposeExpression of your protein of interest in fusion with FLAG at the N-terminus. The tag is cleavable by TEV protease or enterokinase.DepositorTypeEmpty backboneUseFlp-in competentTagsFLAG-TEVExpressionMammalianAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only