175,655 results
-
Plasmid#13820PurposeMammalian expression of human histone deacetylase 1 with flag tagDepositorAvailable SinceFeb. 19, 2007AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1-Flag
Plasmid#208051PurposeEmpty vector for mammalian expression, insert a Flag tag (with ATG) at XhoI site of pcDNA3.1 (-), xhoI site at 5' of flag tag destroyed, xhoI site at 3' of flag tag retained. XhoI in-frame with FlagDepositorTypeEmpty backboneTagsFlagExpressionMammalianPromoterCMVAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
LEGO-AP1x6-GM55
Plasmid#217415PurposeLuciferase expression vector with 6 AP-1 sites and the minimal GM-CSF promoter. Alias: LEGO-GM55-AP-1x6DepositorInsertLuciferase, GFP
UseLentiviral and LuciferaseExpressionMammalianPromoter6 AP-1 sites, Human -55 to +28 minimal CSF2 promo…Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_011
Plasmid#59702PurposeThis lentiviral vector can be used to assay Cas9 activity.DepositorInsertEGFP sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pB-EF1a-CuO-KRAB-dCas9-BFP-CymR-Puro
Plasmid#248161PurposeExpresses KRAB fused to dCas9 and BFP upon cumate inductionDepositorInsertsKRAB-dCas9-HA-tagBFP
HA-CymR-T2A-puro
UseCRISPRTagsHA and tagBFPExpressionMammalianPromoterEf1aAvailable SinceJan. 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
MLM3613
Plasmid#42251PurposeExpresses Cas9 nuclease (Streptococcus pyogenes) from CMV and T7 promotersDepositorInsertStreptococcus pyogenes Cas9
UseCRISPR; Zebrafish expressionPromoterCMVAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
Flag-Keap1
Plasmid#28023DepositorAvailable SinceFeb. 17, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP (AAV Retrograde)
Viral Prep#37825-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. GFP expression control. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable SinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-PEmax for IVT
Plasmid#178113PurposeTemplate for in vitro transcription of PEmaxDepositorInsertPEmax
UseTemplate for in vitro transcriptionTagsSV40 bpNLS and c-Myc NLSMutationDetailed in manuscriptPromoterT7 (inactivated)Available SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] (AAV1)
Viral Prep#84446-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] (#84446). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] plasmid DNA. CAG-driven, Cre-dependent expression of Jaws-KGC-tdTomato-ER2 for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomatoAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (AAV9)
Viral Prep#20298-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (#20298). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin H134R mutant fused to EYFP, for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-EDA in pMAX
Plasmid#120402Purposeenables eukaryotic expression of human EDA (or EIIIA) containing fibronectin based on plasma fibronectin sequenceDepositorAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase
Plasmid#119816Purpose3rd generation lentiviral plasmid for expression of EGFP Firefly Luciferase fusion protein in mammalian cellsDepositorInsertsLuciferase
Puromycin
UseLentiviral and LuciferaseTagsEGFP and V5ExpressionMammalianMutationStop codon removed in the frame of the V5 frame v…PromoterCMV/TO and Human Phosphoglycerate kinaseAvailable SinceJan. 2, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV_hsyn_NES-his-CaMPARI2-WPRE-SV40
Plasmid#101060PurposeAAV vector expressing CaMPARI2 (Kd = 200nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorHas ServiceAAV1InsertCaMPARI2
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_V5-TWIST1
Plasmid#215030PurposeMammalian expression of human TWIST1DepositorInserttwist family bHLH transcription factor 1 (TWIST1 Human)
TagsV5ExpressionMammalianPromoterCMVAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
ER-mRFP
Plasmid#62236PurposePlasmid expresses endoplasmic reticulum targeted mRFP in mammalian cells.DepositorInsertER-mRFP
TagsmRFP1ExpressionMammalianPromotercmvAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Flag beta-1-adrenergic-receptor
Plasmid#14698DepositorAvailable SinceJune 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
CLYBL-Bxb1-LP-v2-TC
Plasmid#194327PurposeCLYBL targeting construct with the Bxb1 landing pad version 2 cassette.DepositorInsertloxP-EBFP2-attP-BleoR-lox251
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_L_EBOV
Plasmid#103052PurposeEncodes Ebola virus L gene (Zaire ebolavirus, Mayinga) under control of the CAG promoterDepositorAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEN-luxCDABE
Plasmid#44918DepositorInsertsigma 70 promoter
UseLuciferaseTagslux transcriptional fusionPromoterem7Available SinceMay 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_3E5E_eGFP
Plasmid#103054PurposeEncodes Ebola virus minigenome with EGFP reporter gene. Minigenome is under control of the CAG promoterDepositorInsertEbola virus (ebolavirus Zaire, Mayinga) minigenome
Tags3E5E eGFP cloned into pCAGGS vector from pCDNA3.1…ExpressionMammalianPromoterCAGAvailable SinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQE-WT-RGVG-M6
Plasmid#70172PurposeExpresses RGVG-M6 T7 RNA polymerase variant with enhanced transcription of 2' modified RNADepositorInsertRGVG-M6 T7 RNA polymerase
TagsHisExpressionBacterialPromoterT5/LacAvailable SinceDec. 16, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAGGS_VP35_EBOV
Plasmid#103050PurposeEncodes Ebola virus VP35 gene (Zaire ebolavirus, Mayinga) under control of the CAG promoterDepositorInsertVP35 gene of Ebola virus (VP35 (Zaire ebolavirus, Mayinga))
ExpressionMammalianPromoterCAGAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CamKII 0.4.Cre.SV40 (AAV5)
Viral Prep#105558-AAV5PurposeReady-to-use AAV5 particles produced from pENN.AAV.CamKII 0.4.Cre.SV40 (#105558). In addition to the viral particles, you will also receive purified pENN.AAV.CamKII 0.4.Cre.SV40 plasmid DNA. CamKII-driven Cre expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_NP_EBOV
Plasmid#103049PurposeEncodes Ebola virus NP gene (Zaire ebolavirus, Mayinga) under control of the CAG promoterDepositorInsertNP gene of Ebola virus (NP Zaire ebolavirus, Mayinga)
ExpressionMammalianMutationsilent mutation (T to C) at position 928 of NP ge…PromoterCAGAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Integrin-Beta1-N-18
Plasmid#55064PurposeLocalization: Integrin/Focal Adhesions, Excitation: 587, Emission: 610DepositorAvailable SinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_VP30_EBOV
Plasmid#103051PurposeEncodes Ebola virus VP30 gene (Zaire ebolavirus, Mayinga) under control of the CAG promoterDepositorAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_3E5E_luciferase
Plasmid#103055PurposeEncodes Ebola virus minigenome with firefly luciferase reporter gene. Minigenome is under control of the CAG promoterDepositorInsertEbolavirus minigenome
UseLuciferaseExpressionMammalianPromoterCAGAvailable SinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-hMLH1dn for IVT
Plasmid#178114PurposeTemplate for in vitro transcription of human MLH1dnDepositorInserthuman MLH1dn (codon optimized) (MLH1 Human)
UseTemplate for in vitro transcriptionMutationDetailed in manuscriptPromoterT7 (inactivated)Available SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hERalpha
Plasmid#101141PurposeMammalian expression of full-length human estrogen receptor-alphaDepositorAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-NR5A1
Plasmid#192915PurposeBarcoded piggybac transposon vector with Dox-inducible expression of NR5A1DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-DTR-GFP (AAV2)
Viral Prep#124364-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-FLEX-DTR-GFP (#124364). In addition to the viral particles, you will also receive purified pAAV-FLEX-DTR-GFP plasmid DNA. CBA-driven, Cre-dependent expression of DTR-GFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterChicken B-actinTagsGFP (Cre-dependent)Available SinceJune 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAC-BETA
Plasmid#53272PurposeContains crtE, crtB, crtI, and crtY carotenoid pathway genes of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces beta-carotene in Escherichia coliDepositorInsertcrtE, crtY, crtI, crtB
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-NFIA
Plasmid#141403PurposeInducible Expression of NFIADepositorAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
ADRA1A-Tango
Plasmid#66213PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA puro
Plasmid#104990PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and puromycin resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
p5E-kdrl
Plasmid#78687Purposekdrl promoter for Gateway cloningDepositorAvailable SinceJune 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(3,5)P2 Probe
Plasmid#211512PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-3,5-Bisphosphate (PI(3,5)P2) from bacteriaDepositorInsertSnxA-2xPX
Tags6xhis-SNAPExpressionBacterialAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(3)P Probe
Plasmid#211508PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-3-Phosphate (PI(3)P) from bacteriaDepositorAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only