We narrowed to 60,538 results for: Gene
-
Plasmid#72123PurposeExpresses the extracellular region of the PlexinA2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only
-
LIR-wtloxP-TRE-CAG-Frt-red-puro-3xPA-Frt-GFP(mVenus)-KrasG12D-cMyc-SV40LT-IRES-KRABoff-PA-TRE-loxP257-RIR
Plasmid#67277Purposeinducbile color change and cancer regulation: FlpO recombinase dependent expression of KrasG12D cMyc and SV40 large T antigen with doxycycline inducible downregulation through tetKRAB system.DepositorInsertsfirst casette contain a red fluorescent protein (katushka) linked to puromycin resitance gene through an E2A site
second cassette contains mVENUS-kras-cmyc-SV40LT-KRABoff
TagsmTQ2 blue fluorescent and red flourescent gene ka…ExpressionMammalianPromoterCAGAvailable SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Jun lab tunable CRISPRi strain
Bacterial Strain#86400PurposeStrain SJ_XTL219 Genotype: MG1655 PBAD_dcas9 ΔlacI ΔaraE araFGH<>spec lacY A177C, galM<pBBa-J23119-tet-sacB-handle-termDepositorBacterial ResistanceSpectinomycin and hygromycinAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60227PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA targeting the mouse gene NeuN. AAV backbone.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
Mouse Chromatin Regulator Library
Pooled Library#200011PurposeKnockout library targeting a comprehensive set of mouse genes with annotated function as chromatin regulators.DepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLp_3050sNuc
Plasmid#122030PurposePlasmid for heterologous protein secretion in Lactobacillus plantarum and L. sakeiDepositorInsertsignal peptide Lp_3050
ExpressionBacterialPromotersppAAvailable SinceNov. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
Rinehart & Söll Phosphoprotein Synthesis Kit
Plasmid Kit#1000000020PurposeEngineered system for specific incorporation of phosphoserine into protein of interest.DepositorApplicationGene Expression and LabelingVector TypeBacterial ExpressionAvailable SinceMarch 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
PB-TetON-dual-SunTag-Hygro
Plasmid#121119PurposeEndogenous gene activation with the SunTag CRISPR activation systemDepositorInsertdCas9-GCN4x10_scFv-VP64
UseCRISPRExpressionMammalianPromoterTet-ONAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_+1D
Plasmid#149389PurposeP. aeruginosa PA14 CRISPR2 locus, with 1bp addition downstream of IHFprox siteDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutation1bp inserted downstream of the IHFprox sitePromoterpBADAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g1 (BB22)
Plasmid#139457PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g1 (BB34)
Plasmid#139452PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g2 (BB23)
Plasmid#139458PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Islr-AP-His
Plasmid#71950PurposeExpresses the entire Islr protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema5b-AP-His
Plasmid#72036PurposeExpresses the extracellular region of the Sema5B protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema5b-Fc-His
Plasmid#72162PurposeExpresses the extracellular region of the Sema5B protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxnc1-AP-His
Plasmid#72005PurposeExpresses the extracellular region of the PlexinC1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
MALT1 (3BFO)
Plasmid#25216PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertmalt1.226.314 (MALT1 Human)
TagsHisExpressionBacterialMutationContains amino acid residues 226-314 of Isoform 2Available SinceAug. 12, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
LLP185 pLVP-dCas9-DNMT3a V2
Plasmid#100936PurposedCas9 and DNMT WT on C terminus, 4 NLS, driven by pGK promoter, with P2A site and PURO gene, within a lentiviral transfer backboneDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A Human, S.pyogenes)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-FLEX-fwd[Chrimson-tdT]
Plasmid#59137PurposeExpression vector for Chrimson-tdTomato in a floxed/forward-reading, Cre-dependent manner (Cre turns gene off)DepositorInsertChrimson-tdTomato
UseCre/LoxTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMflPT-o4
Plasmid#101315PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and pac resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
pac resistance gene
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMflST-o4
Plasmid#101316PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and aadA1 resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
aadA1 resistance gene
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ExRai-CKAR
Plasmid#118409PurposecpGFP-based excitation-ratiometric biosensor for monitoring Protein Kinase C activity.DepositorInsertExRai-CKAR
Tags6xHIS, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianPromoterCMVAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN565
Plasmid#49990Purposeexpresses an attenuated T7 RNAP under an isopropyl β-d-1-thiogalactopyranoside (IPTG) inducible controlDepositorInsertT7 RNAP*
UseSynthetic BiologyTagsumuD degradation tagExpressionBacterialMutationR632SPromoterpTac-symmetricAvailable SinceJan. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 NSP3_nostop
Plasmid#149306PurposeGateway-compatible Entry vector, with insert of NSP3 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1. Does not contain stop codon.DepositorInsertNSP3 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceMay 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYPQ-CBE-Cas9n-Act3.0
Plasmid#178955PurposeIt consists of a Cas9 nickase (D10A) fused with a cytidine deaminase (A3A/Y130F) and MS2-SunTag-activators (ScFv-sfGFP-2xTAD), enabling simultaneous C to T conversion and gene activation.DepositorInserthA3A-zCas9-UGI-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLT 653
Plasmid#59996PurposeExpresses a hybrid dsRNA corresponding to the Caenorhabditis elegans dhc-3/klp-16 genes in bacteria; ingestion of the bacteria by C elegans produces an RNAi response & leads to more male progenyDepositorExpressionBacterialMutationpartial genomicAvailable SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-Neo-TGmiR-Luc
Plasmid#25745PurposeControl lentiviral vector with Tet-based inducible expression of Luciferase miR30-based shRNA and GFP, constitutive Neomycin resistance gene coexpression.DepositorInsertLuciferase miR-shRNA
UseLentiviral and RNAiTagsGFPExpressionMammalianAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRosa26-TG
Plasmid#40026DepositorInsertsT (ATG)
beta-globin intron
Neo
GFP
diphteria toxin A
ExpressionMammalianMutationdeleted nucleotides 1-274 and insertion of FRT, …PromoterCAG (chicken beta globin promoter and CMV enhance…Available SinceOct. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.b-Fc-His
Plasmid#72111PurposeExpresses the extracellular region of the Netrin G1, isoform b protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only