We narrowed to 11,118 results for: kit
-
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3043(gRNA XI-1)
Plasmid#73285PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGE6
Plasmid#79476PurposesgRNA shuttle vector; module 1EDepositorInsertpAtU6-ccdB-sgRNA (ccdB(letD) )
UseCRISPR and Synthetic BiologyMutationBsaI site eliminatedAvailable sinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGE8
Plasmid#79463PurposesgRNA shuttle vector; module 2EDepositorInsertpAtU6-ccdB-sgRNA (ccdB(letD) )
UseCRISPR and Synthetic BiologyMutationBsaI site eliminatedAvailable sinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET24-His6-GFP1-10
Plasmid#253053PurposeEncodes 6xHistidine-tagged GFP1-10 fluorescence complementation fragment in a modified pET24d vector backbone for expression in E. coliDepositorInsertGFP
ExpressionBacterialAvailable sinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
1456_pDEST_miniTol2_R4-R2_Cryst-eGFP
Plasmid#171795PurposepDEST miniTol2-clone for R4-R2 3-component gateway assembly (p5E + pME). Include a eGFP selection marker (Crystallin promoter Lens/Eyes)DepositorTypeEmpty backboneExpressionBacterialAvailable sinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMLS236
Plasmid#73684PurposeSapTrap 3-site Destination vector for internal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXs-NKX2.2
Plasmid#134670PurposeRetroviral expression of mouse Nkx2.2DepositorInsertNkx2.2 (Nkx2-2 Mouse)
UseRetroviralAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB3049(gRNA XII-4)
Plasmid#73291PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-4DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMC-1-WDV-LRS-L-11
Plasmid#197720PurposePhytobrick (MoClo) Level 0 PartDepositorInsertWDV LRSL in c-sense with GG expansion to v-sense ORF position
ExpressionPlantAvailable sinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMM0638
Plasmid#129005PurposeIntegration vector for optogenetic machinery (pSTRONG-VP16-CIB1/pMEDIUM-ZCRY2PHR) and pZF-mRUBY2DepositorInsert5' URA3 -pTEF1-SV40NLS-VP16-CIB1-tENO1-pRPL18B-SV40NLS-ZiF268DBD-CRY2PHR-tSSA1-pZF(BS)-mRUBY2-tADH1-URA3 URA3 3'- KanR-ColE1
ExpressionYeastAvailable sinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSW725 - pUFO>>
Plasmid#116000Purposedestination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expressionDepositorInsertpUFO:GR-LhG4:tRBCS:F-H adapter-H-A adapter::pOp6:SP(ER)-mTurquoise2-HDEL:tUBQ10::SulfR
TagsHDEL and SP(ER)ExpressionPlantAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0013
Plasmid#117549PurposeLevel 1 Golden Gate Cassette: LbCas12a expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + LbCas12a (with stop codon) (pEPOR0SP0007)+ Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available sinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB3053(gRNA X-2, XI-5, XII-4)
Plasmid#73295PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-2, XI-5, and XII-4DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFTK093
Plasmid#171365PurposeVector part (LVL1) from the Fungal Modular Cloning ToolKit.DepositorInsertsgRNA transcription unit (MoClo lvl1 unit), P-gpdA-HH-sgRNA-HDV-Ttrpc, replacable LacZ gene
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLaNGo11-7
Plasmid#126055PurposeA self-assembling split-GFP based Golden Gate vector to determine protein targeting to plastids in plant cellDepositorInsertschloroplastic FNR transit peptide
ccdB cassette (BsaI)
GFP11x7 (5 aa linker)
UseBinaryTagsGFP1-10ExpressionPlantAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPTK013-3a-Invertase-αMFΔ
Plasmid#84972PurposeType 3a, Invertase followed by αMFΔ - secretion signalDepositorInsertInvertase followed by αMFΔ secretion tag
UseSynthetic BiologyExpressionYeastPromoterNonAvailable sinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPTK016-3-RFP_Intra
Plasmid#84975PurposeType 3, Red fluorescent proteinDepositorInsertRed fluorescent protein
UseSynthetic BiologyExpressionYeastMutationBsaI site removed (1677 c to g and 1794 a to g)PromoterNonAvailable sinceMarch 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-EYFP
Plasmid#48351PurposeContributes the coding sequence for EYFP as the 3’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEYFP
UseGateway CloningMutationContains a stop codon.PromoternoneAvailable sinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hFOXH1GR
Plasmid#59311PurposeForced expression of human FOXH1GRDepositorInsertFOXH1 (FOXH1 Human)
UseRetroviralTagscGR - hormone binding domain of glucocorticoid re…ExpressionMammalianAvailable sinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only