We narrowed to 21,829 results for: SPR
-
Plasmid#124846PurposeMutagenesis of Slc17a7DepositorInsertSlc17a7 (Slc17a7 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMH-Cas9-gate
Plasmid#113742PurposeGateway destination vector encoding Maize ubiquitin promoter driving Cas9 and 35S promoter driving hygromycin for selection in plants.DepositorInsertCas9
UseCRISPR and Gateway CloningPromoterZ. Mays ubiquitin promoter, 35S promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR
Plasmid#68347PurposeAAV plasmid expressing the FlpO recombinase. with empty gRNADepositorInsertFlPO
UseAAV and CRISPRExpressionMammalianPromoterCAGAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBZ210-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Ec86RT-NLS-T2A-mCherry
Plasmid#170185PurposeExpression vector for a sgRNA against BFP and spCas9-Ec86 RT fusion protein linked to mCherry via a T2A peptide. Donor template An was inserted in the Retron Ec86 msr-msd region by SpeI and AvrII.DepositorInsertsEc86 RT
Retron Ec86 msr-msd
BFP-to-GFP conversion donor template An
UseCRISPRTagsNLSExpressionMammalianPromoterCBh and hU6Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-spCas9 ABE-Umax
Plasmid#222138PurposeAdenine base editor with modified TadA variant for A-to-G base editing in zebrafishDepositorInsertModified TadA-nSpCas9 (cas9 Synthetic)
UseCRISPR; Zebrafish expressionTagsbipartite NLSPromoterT3Available SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL3402 (pTnsABf_Pse)
Plasmid#200901PurposeExpresses human codon-optimized Pseudoalteromonas TnsA-TnsB fusion from a CMV promoter.DepositorInsertPseTnsA-TnsB
TagsInternal NLS between TnsA-TnsB fusionExpressionMammalianAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-B
Plasmid#177787PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC57-GFP-SFPQ-RT
Plasmid#97090PurposeEncodes a HR repair template for knock-in of an EGFP insert that fused to the 5'-end of human SFPQ gene, without disturbing its promoter. Best used with px330-GFP-SFPQ vector.DepositorInsertEGFP-SFPQ-RT (SFPQ Human)
UseCRISPRAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-117G-hyA3A-BE4max
Plasmid#157945PurposeLentiviral expression of hyA3A-BE4maxDepositorInsertLenti-117G- hyA3A-BE4max
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5_miniTurbo-C12orf49
Plasmid#155111Purposetransfection plasmid for the exogneous expression of N-terminal miniTurbo-tagged C12orf49 for generation of FlpIn cell lines for BioIDDepositorInsertC12orf49 (SPRING1 Human)
TagsminiTurboExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDe-CAS9-D10A
Plasmid#61477Purposebased on pDe-CAS9, encodes Cas9 D10A nickase variantDepositorInsertCas9-D10A
UseCRISPRExpressionPlantMutationcatalytic Asp10 changed to AlaPromoterPcUbi4-2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-GG-OCT4-1-5-PGK-Puro
Plasmid#102893PurposePiggyBac transposon system construct with 5 concatenated U6 promoter driven transcriptional cassettes for the activation of OCT4. Contains PGK-puro selection cassette.DepositorAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNeo/Cre
Plasmid#67594PurposeExpresses an Neomycin-targeting gRNA and Cre-recombinaseDepositorInsertsgNeo
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX458_Ruby
Plasmid#110164PurposeCas9 from S. pyogenes with Ruby2, and cloning backbone for sgRNADepositorInserthSpCas9
UseCRISPRTags3xFLAG and Ruby2ExpressionMammalianAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYFP-NEAT1m_v1-RT
Plasmid#97089PurposeEncodes a HR repair template for knock-in a YFP expression cassette downstream of the poly(A) signal of human NEAT1_1 isoform. Best used with px330-NEAT1m_v1 vector.DepositorAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CMV-Cas9-P2A-HygR
Plasmid#164133PurposeLentiviral construct for the expression of SpCas9 driven by CMV promoter in mammalian cellsDepositorAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
SMC2-mAC donor (Hygro)
Plasmid#140648PurposeSMC2 tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Clta KI
Plasmid#131483PurposeEndogenous tagging of Clathrin light chain α: N-terminal (amino acid position: M1)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta into TRBC1 HDRT Source (pTR 277)
Plasmid#112024PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-beta with 1G4 NYESO TCR-betaDepositorInsertNYESO beta into TRBC1 HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only