We narrowed to 21,829 results for: SPR
-
Plasmid#112013PurposeDNA sequence source for amplifying an HDR template to tag endogenous human RAB11A gene with mCherryDepositorInsertRAB11A-mCherry HDRT (RAB11A Human)
UseCRISPR and Synthetic BiologyAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterSV40, CMV promotersAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL1180-HR-Aag2-loxP-PUb-RFP-loxP-3xFLAG-AGO1
Plasmid#162164PurposeSelectable homology donor template for Aag2 cell AGO1DepositorInsertsRFP
3xFLAG
UseCRISPR and Cre/Lox; Homology donor templateTagsAGO1 homology and loxPExpressionInsectPromoterAe. aegypti PUb and endogenous AGO1Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
PRKDC gRNA (BRDN0001145772)
Plasmid#77862Purpose3rd generation lentiviral gRNA plasmid targeting human PRKDCDepositorAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK3 gRNA (BRDN0001147876)
Plasmid#75967Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR_219
Plasmid#164559PurposeLentiviral vector that encodes two sgRNA expression cassettes. Also encodes the fluorophore violet-excited GFP (Vex) as a marker of transduction.DepositorInsertsFirst sgRNA cassette
Second sgRNA cassette
UseCRISPR and Lentiviral; Dual sgrnaExpressionMammalianPromoterHuman U6 and Mouse U6Available SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmiHiFiCas9
Plasmid#164832PurposemiHiFiCas9 expressing plasmidDepositorInsertmiHiFiCas9 (contains Brex27 at sequence 5031-5138).
UseCRISPRTagsFLAG and NLSExpressionMammalianMutationchange R 691 to APromoterCMVAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV-EF1aGFP2AKAT7-W
Plasmid#159292PurposeLentiviral vector expressing GFP and KAT7 (gRNA-resistant) driven by human EF1a promoterDepositorInsertKAT7 (KAT7 Human)
UseLentiviralExpressionMammalianMutationCRISPR sites mutated (gRNA ID. 5 and A10)Promoterhuman EF1a promoterAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV312.3
Plasmid#119944PurposeExpresses C-terminal Npu DnaE Intein-SaKKH-BE3, tagRFP, and sgRNA in mammalian cellsDepositorInsertC-Intein (Npu DnaE) - C-terminal (740)SaKKH-BE3
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceMay 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a-Cas9-2XNES-2ERT2-GCN4-SV40-Zeo
Plasmid#120555PurposeExpress Cas9, 2xNES, 2 tandem ERT2 and GCN4 in mammalian cellsDepositorInsertCas9, NES, ERT2 and GCN4
UseLentiviralExpressionMammalianAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ239
Plasmid#108859PurposeFnCpf1 Gateway entry plasmidDepositorInsertFnCpf1
UseCRISPR; Gateway compatible cpf1 entry cloneTagsNLSExpressionPlantMutationCpf1 is rice codon optimizedAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cas12aUltra_5XNLS
Plasmid#218775PurposeHis-TEV-Cas12aUltra-BPSV40_cMyc_NP_5NLSDepositorInsert5xNLS-BPSV40-NLP-cMyc-cMyc-BPSV40- AspCas12a
UseCRISPRTags6XHis (C terminal), HA, Nucleoplasmin, SV40, and …ExpressionBacterialMutationNucleotides mutations were made to encode for arg…Available SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-VRER-P2A-EGFP (RTW3160)
Plasmid#139991PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRER(D1135V/G1218R/R1335E/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-VRER with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationVRER=D1135V/G1218R/R1335E/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCC_04 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-xCas9NG-NLS-2A-Puro-WPRE
Plasmid#139089PurposeExpresses human codon-optimized xCas9-NG nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertxCas9-NG
UseCRISPR and LentiviralExpressionMammalianMutationA262T,R324L, S409I, E480K, E543D, M694I, L1111R, …Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
MAPK1 gRNA (BRDN0001149093)
Plasmid#77788Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ERBB2 gRNA (BRDN0001146057)
Plasmid#76376Purpose3rd generation lentiviral gRNA plasmid targeting human ERBB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ERBB2 gRNA (BRDN0001148320)
Plasmid#76378Purpose3rd generation lentiviral gRNA plasmid targeting human ERBB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only