We narrowed to 1,236 results for: poli
-
Plasmid#110412PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMSP2N2
Plasmid#29520DepositorInsertMSP2N2
Tags7-His tagExpressionBacterialMutationtandem MSP; His-tag on N-terminus followed by spa…Available SinceMay 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET32a-Nb11-P2
Plasmid#236499PurposeExpresses anti-Apolipoprotein A1 nanobody Nb11 as a fusion protein with coiled coil P2 in bacteria.DepositorInsertNb11-P2
ExpressionBacterialAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pBAD24-sfGFPx2
Plasmid#51559PurposeSuperfolder GFP ORF cloned into pBAD24 for expression in E. coli. It contains additional aminoacids in the N and C terminus (polilinker sequences for cloning proteins in frame with GFP)DepositorInsertsuperfolder GFP
TagsGLESTCRHASLAVLADERRFSA and MARARAExpressionBacterialMutationContains additonal aa in the N and C terminus (in…Available SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFS462
Plasmid#89065Purposehis7 integration plasmid with Z3EVpr:GFPDepositorInsertZ3EV promoter GFP-NLS leu1 C-terminal 300 nt
UseS. pombe his7 integration vectorPromoterZ3EVAvailable SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBEAST_J23101-amidase
Plasmid#128135PurposeThe cell-free adapted backbone, pBEAST, expressing the amidase enzyme gene (benzamid to benzoate) under control of the constitutive promoter J23101, and RBS B0032DepositorInsertamidase
UseSynthetic BiologyExpressionBacterialPromoterJ23101Available SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
rat APOBEC1
Plasmid#112858Purposeplasmid for expression of rat APOBEC1 in mammalian cellsDepositorAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
rat APOBEC1 E63A
Plasmid#112861Purposeplasmid for expression of a catalytically inactive rat APOBEC1 mutant in mammalian cellsDepositorArticleInsertAPOBEC1 (Apobec1 Rat)
ExpressionMammalianMutationchanged Glutamic acid 63 to AlaninePromoterCMV promoterAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET32a-Nb19-P4S
Plasmid#236500PurposeExpresses anti-Apolipoprotein A1 nanobody Nb19 as a fusion protein with coiled coil P4S in bacteria.DepositorInsertNb19-P4S
ExpressionBacterialAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1delltaH5
Plasmid#71714PurposeMembrane scaffold protein (MSP), helix 5 deletionDepositorAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1deltaH4H5
Plasmid#71716PurposeMembrane scaffold protein (MSP), helix 4+ helix 5 deletionDepositorInsertApolipoprotein A1 (APOA1 Human)
ExpressionBacterialAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFE-Rs-FI-prk
Plasmid#162697PurposeExpresses R. spaeroides Form IC rubisco and S. elongatus PrkDepositorInsertR. spaeroides Form IC rubisco and S. elongatus Prk
TagsN terminal 6x His tag on PRKExpressionBacterialPromoterPLtet0-1 promoterAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1deltaH4-H6
Plasmid#71717PurposeMembrane scaffold protein (MSP), helix 4 to 6 deletionDepositorInsertApolipoprotein A1 (APOA1 Human)
ExpressionBacterialAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1delltaH4
Plasmid#71713PurposeMembrane scaffold protein (MSP), helix 4 deletionDepositorAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T_PV1_VP1
Plasmid#202071PurposeBacterial expression of VP1 protein from poliovirus 1 (PV1). Contains N-terminal GST-tag and C-terminal His6-tag.DepositorInsertPV1 VP1 protein with Histag
Tags6xHis-tag and GSTExpressionBacterialPromotertacAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCB
Plasmid#162699PurposeExpresses pHnCB10 derived carboxysome operon and prkDepositorInsertpHnCB10 derived carboxysome operon, prk
ExpressionBacterialPromoterPLtet0-1 promoterAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
A3Bctd-max
Plasmid#198888PurposeExpress A3Bctd-max BE4max-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
Tags6x His and NLSExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
A3Bmax
Plasmid#207167PurposeExpress full-length human A3B in a BE4max-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B (APOBEC3B Human)
TagsNLS and NLS, 6x HisExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJUMP18-lambdaRED_NOC
Plasmid#127032PurposeBasic Part NOC- Complete ORF; LambdaRED / _RED; Policistronic "NOC" part with coding regions for the three lambda red proteins (the first; gam; doesn't have RBS; but bet and exo genes have RBS).DepositorInsertPart ?RED_NOC
UseSynthetic BiologyExpressionBacterialMutationNoneAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-26 (GB1001)
Plasmid#68208PurposeProvides the A. thaliana U6-26 RNA polIII promoter as a level 0 GoldenBraid partDepositorInsertAtU6-26 promoter
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP ratAPOBEC1 L173A/G227A
Plasmid#167169PurposeExpresses rat APOBEC1 L173A/G227A in mammalian cells. Please note that this does not express GFP.DepositorArticleInsertAPOBEC1 (Apobec1 Rat)
ExpressionMammalianMutationchanged Leucine 173 to Alanine; changed Glycine 2…PromoterCMV promoterAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
rat APOBEC1-EGFP
Plasmid#112857Purposeplasmid for the expression of a rat APOBEC1-EGFP C-terminal fusion proteinDepositorInsertapolipoprotein B mRNA editing enzyme, catalytic polypeptide 1 (Apobec1 Rat)
ExpressionMammalianPromoterCMV promoterAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUPD_OsU3 (GB1184)
Plasmid#68209PurposeProvides the O. sativa U3 RNA polIII promoter as a level 0 GoldenBraid partDepositorInsertOsU3 promoter
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Nectin-3 in situ probe
Plasmid#45633DepositorInsertNectin-3 in situ probe (Nectin3 Mouse)
UseIn situMutationfragment contains bp# 1626-2039 of NM_021495Available SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCB’
Plasmid#162703PurposepCB reconstructed after selection for CCMB1 growth on glycerol under ambient airDepositorInsertpHnCB10 derived carboxysome operon, prk
ExpressionBacterialMutation5513T>G (tetR E37A); 7758G>T (second tet op…PromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBabePuro-ApoECDS
Plasmid#42949DepositorAvailable SinceMarch 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPV-H1-ccdB-mEF1α-RiH
Plasmid#100598PurposepiggyBac vector for sgRNA cloningDepositorTypeEmpty backboneUsePiggybac vectorExpressionMammalianPromoterHuman H1 PolIII promoter, human FTH1 promoter, mo…Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1deltaH4/2H5
Plasmid#71715PurposeMembrane scaffold protein (MSP), helix 4/2 + helix5 deletionDepositorAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1deltaH4/2
Plasmid#71712PurposeMembrane scaffold protein (MSP), half of helix 4 truncatedDepositorAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
A3B-Cas9n-UGI-NLS
Plasmid#198889PurposeExpress full-length A3B BE3-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B (APOBEC3B Human)
TagsNLSExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
psiCheck-ApoE3'UTR
Plasmid#41846DepositorInsertApoE 3'UTR (APOE Human)
UseLuciferaseAvailable SinceJan. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
A3Bctd-L7G-Cas9n-UGI-NLS
Plasmid#198886PurposeExpress A3Bctd-L7G BE3-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
TagsNLSExpressionMammalianMutationLoop 7 of A3GPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
A3Bctd-D314E-Cas9n-UGI-NLS
Plasmid#198887PurposeExpress A3Bctd-D314E BE3-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
TagsNLSExpressionMammalianMutationD314EPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
eA3Ai-Cas9n-UGI-NLS
Plasmid#207165PurposeExpress A3A with an N57G point mutation and an intron in a BE3-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3A (APOBEC3A Human)
TagsCas9-UGI--NLSExpressionMammalianMutationN57GPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
eA3Ai-max
Plasmid#207166PurposeExpress A3A with an N57G point mutation and an intron in a BE4max-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3A (APOBEC3A Human)
TagsCas9-UGI-UGI-NLS and NLSExpressionMammalianMutationN57GPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
p7SL-neo-TET
Plasmid#51285Purposeexpresses human 7SL RNA, using its own polIII enhancer, and tagged with the self splicing intron neo cassetteDepositorInsert7SL RNA (RN7SL2 Human)
TagsneoTET cassette with a tetrahymena self-splicing …ExpressionMammalianPromoter7SL upstream pollII enhancerAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKb-TnpB2
Plasmid#215334PurposeISDra2 expression driven by PolII promoter ; 20 bp guide RNA can be cloned in BsaI siteDepositorInsertRice codon optimized ISDra2 TnpB
TagsNot applicableExpressionPlantPromoterRice ubiquitin promoter for TnpB and maize ubiqui…Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only