We narrowed to 11,816 results for: nts
-
Plasmid#8511DepositorInserthAur-A (AURKA Human)
UseRetroviralExpressionMammalianMutationD274A, catalytically dead mutantAvailable SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
Murine CD3 WTdelta-F2A-gamma-T2A-epsilon-P2A-zeta pMIG II
Plasmid#52092PurposeRetroviral expression of all four WT CD3 subunits, co-expressed with EGFPDepositorInsertsUseRetroviralTagsF2A, IRES-EGFP, P2A, and T2AExpressionMammalianAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
YFP NLS Beta-Actin
Plasmid#60613PurposeEncodes YFP and NLS tagged beta-actinDepositorAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBABE-zeo smallT
Plasmid#8583DepositorAvailable SinceSept. 26, 2005AvailabilityAcademic Institutions and Nonprofits only -
Lyn-FKBP-FKBP-CFP (LF2C)
Plasmid#20149DepositorAvailable SinceMarch 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
Adeno Cas9
Plasmid#64072PurposeAdenoviral vector for the expression of the Cas9DepositorTypeEmpty backboneUseAdenoviralTagsFLAGPromoterU6 and CBhAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHes1(2.5k)-luc
Plasmid#43806DepositorInsertHes1 Promoter (Hes1 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationContains the murine Hes1 promoterPromoterHes1 PromoterAvailable SinceMarch 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
1072 pBabe puroL myr Akt K179M T308A S473A
Plasmid#9015DepositorInsertAkt1 K179M T308A S473A (AKT1 Human)
UseRetroviralTagsHA and MyrExpressionMammalianMutationK179M T308A S473AAvailable SinceNov. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pJK02
Plasmid#105133PurposeClostridium difficile CRISPR-cas9 mutagenesis plasmid traJ oriTDepositorInsertsUpstream & Downstream pyrE deletion region
tetR
Cas9
gRNA
UseE. coli - c. difficile shuttle vectorAvailable SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZS157 CRISPEY RT/Cas9
Plasmid#114454PurposeYeast Integration Plasmid for galactose inducible Ec86-RT and SpCas9 expressionDepositorInsertSpCas9, Ec86-RT
UseCRISPRTagsSV40-NLSExpressionYeastMutationS. cerevisiae codon optimizedPromoterGAL1-GAL10Available SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
Luc-T20
Plasmid#177941PurposeTransient mammalian expression of Luc2 (firefly luciferase) along with SARS-CoV-2 sequence 20080-22222 (T20) within the 3'UTR. Resulting transcript is packaged into SARS-CoV-2 virus-like particles.DepositorInsertLuc2 (ORF1ab )
ExpressionMammalianAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBudORF2-CH
Plasmid#51289Purposeexpresses the codon optimized ORF2 of L1RP with his tagDepositorAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP (AAV5)
Viral Prep#117382-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified pAAV-hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
PaGFP-UtrCH
Plasmid#26738DepositorInsertUtrophin
UseReporter for f-actinTagsphotoactivatable GFPExpressionMammalianMutationCalponin homology domain of utrophin (aa# 1-261)Available SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7f-WPRE (AAV8)
Viral Prep#104488-AAV8PurposeReady-to-use AAV8 particles produced from pGP-AAV-syn-jGCaMP7f-WPRE (#104488). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7f-WPRE plasmid DNA. Synapsin-driven GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-3xFLAG-Pontin
Plasmid#51635PurposeMammalian expression of 3xFLAG tagged pontin, N-terminal.DepositorAvailable SinceMay 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMDC32-HPB
Plasmid#32078DepositorTypeEmpty backboneUseGateway destination binary vectorTagsHA-Prescission-BiotinPromoter35S promoterAvailable SinceDec. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1 INI1
Plasmid#1953DepositorAvailable SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only