We narrowed to 9,463 results for: Pol;
-
Plasmid#208041PurposeEnables constitutive expression of TurboID alone; RBXN represents a EcoR1-BsiW1-Xba1-Not1 polylinker; selection with blasticidinDepositorInsertTurboID
UseLentiviralPromoterEFSAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTEF:ATP
Plasmid#92179PurposeHO-TEF1p-ATeam1.03-KanMX4-HO. Codon optimized for yeast version of the ATeam1.03 ATP FRET sensor (originally from Imamura et al. PNAS, 2009 ), expressed via the TEF1 promoter. HO locus integration.DepositorInsertATeam1.03 codon optimized for yeast (Saccharomyces cerevisiae)
UseIntegration and expression into yeast.TagsYeast codon optimized mseCFP (donor) and cp173-mV…ExpressionYeastPromoterTEF1pAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
GIPR-DuET
Plasmid#213252PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFPZNF598-9P-9A
Plasmid#141192PurposeExpresses GFP-ZNF598 mutated in polyproline streches in mammalian cells, can be used to make inducible cell lineDepositorInsertZNF598 (ZNF598 Human)
TagsGFPExpressionMammalianMutationall 3 proline repeats are mutated to Alanine (9xP…PromoterCMVAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hPPP3CA-FLAG
Plasmid#179134PurposeExpression vector of human protein phosphatase 3, catalytic subunit, alpha isoform (PPP3CA) tagged with FLAG at C-terminus, CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, catalytic subunit, alpha isoform (PPP3CA Human)
TagsFLAGExpressionMammalianAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-C Med12His
Plasmid#49240Purposeexpresses human Med12 with His tag in insect cellsDepositorAvailable SinceNov. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MYO7A-TAIL
Plasmid#89585PurposeExpression plasmid for a positive control bait protein in NanoSPD 2.0 assays.DepositorInsertMYO7A (Myo7a Mouse)
TagsEGFPExpressionMammalianMutationTruncation encoding amino acids 870-2166 of MYO7A…PromoterCMVAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
HAP40 1-371
Plasmid#124060PurposeBaculovirus expression vector for HAP40 protein (aa 1-371) in insect cellsDepositorInsertHAP40 (F8A1 Human)
UseBaculovirus expressionTags6x His and TEV cleavage sitePromoterpolyhedrinAvailable SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.MTF2
Plasmid#125169PurposeExpresses human MTF2 in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Endo-INPP5E
Plasmid#236005PurposeEndosome-targeted inositol polyphosphate 5 phosphatase (INPP5E); hydrolyzes 5-phosphate in PI(3,4,5)P3 and PI(4,5)P2.DepositorInsertEndo-INPP5E (INPP5E Human, Synthetic)
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and mChe…ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-N-3XFLAG-Dvl2
Plasmid#123587DepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-NS1
Plasmid#175276PurposeAAV vector mediating bicistronic expression of NS1 gene of YFV-17D and dTomato with NLSDepositorInsertNonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsNLS-dTomato (P2A cleavage)PromoterSynapsinAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1 human full-length CENP-E-mNeon-6xHis
Plasmid#180484PurposepFastBac1 human CENP-E-mNeon-His, containing a 3c protease cleavage site between mNeon and His tag. Codon optimized for expression in Sf9 cellsDepositorInsertCENP-E (CENPE human, Human, Synthetic)
TagsmNeon-6xHisExpressionInsectPromoterpolyhedrin promoterAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.PHF1
Plasmid#125167PurposeExpresses human PHF1 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3E-WPRE-SV40-pA (JDW 922)
Plasmid#224545PurposeA Gateway compatible 3' entry clone containing a woodchuck herpes simplex virus regulatory element (WPRE) to stabilize mRNA upstream of an SV40 polyADepositorInsertWPRE-SV40-pA
UseGateway cloningAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
KAT14-pDEST10
Plasmid#118382PurposeHIS-tagged insect cell expression vector with KAT14.DepositorAvailable SinceMay 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1-dTomato
Plasmid#175278PurposeAAV vector mediating inducible bicistronic expression of NS1 gene of YFV-17D and dTomatoDepositorInsertNS1; dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsdTomato (from bidirectional promoter)Promoterbidirectional TRE promoterAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shLuc.mKO2
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDUET-1-alpha-synuclein-mCerulean3-His6
Plasmid#110061PurposeFor bacterial expression of human alpha-synuclein, carboxyl terminally tagged with mCerulean3 and poly-histidinesDepositorAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFB-GST-IRP2
Plasmid#226621PurposeExpresses human IRP2 in insect cellsDepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
MmEos3.2
Plasmid#203754PurposeEncodes the membrane anchor of Src including the first 15 resideues of the N terminus, with 1 myristoylation and short polybasic sequence, with mEos3.2 fused to the C terminus. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLD003-pCMV-APOBEC-Cas9(D10A)-rPB(8kD)
Plasmid#165445PurposeExpresses ACX, rPB(8kD) in mammalian cellsDepositorInsertAPOBEC-nCas9-rPB(8kD)
ExpressionMammalianAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFAST-BAC BAF57/SMARCE1-His
Plasmid#177861PurposeTransfer vector to generate recombinant baculovirus expressing BAF57/SMARCE1-His proteinDepositorInsertSMARCE1 (SMARCE1 Human)
TagsHis tag at C-terminus with GGGGS linkerExpressionInsectPromoterpolyhedrinAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKE13-ISceI-fabp10a:CreERT2
Plasmid#198242PurposeFor I-SceI-mediated transgenesis in zebrafish; fabp10a promoter driving tamoxifen-inducible Cre recombinaseDepositorInsertsUseZebrafish transgenesisAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC6
Plasmid#224346PurposeExpresses human KDAC6 (HDAC6) in insect cellsDepositorAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFastBac1_GI.1_N116C-G193C
Plasmid#162580PurposeExpresses norovirus GI.1 VP1 protein with mutations N116C-G193C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationAsparagine 116 was mutated to Cysteine and Glycin…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-FRT3-stop-FRT-LexGAD-FRT3-Gal4 attB
Plasmid#52890Purpose"CoinFLP-LexGAD/Gal4" - Expresses LexGAD or Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express LexGAD, or FRT3-FRT3 pair to express Gal4.DepositorInsertsExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTYB11-PTBP1-RRM2CCtoSS
Plasmid#89154Purposerecombinant expression of PTBP1-RRM2 C250S,C251S in e.coliDepositorInsertPolypyrimidine Tract Binding Protein 1 RNA Recognition Motif 2 mutant C250S, C251S (PTBP1 Human)
TagsIntein and chitin binding domainExpressionBacterialMutationmutations: Cys 250 to Ser, Cys 251 to SerPromoterT7Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_Q62C-A140C
Plasmid#162581PurposeExpresses norovirus GI.1 VP1 protein with mutations Q62C-A140C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationGlutamine 62 changed to Cysteine and Alanine 140 …PromoterpolyhedringAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only