We narrowed to 8,906 results for: sgrna
-
Plasmid#183122PurposepLentiGuide modified to express mCherry and an sgRNA targeting EPAS1DepositorInsertsgEPAS1-1
UseLentiviralPromoterU6Available SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas34
Plasmid#82386PurposesgRNA targeting YFP expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
doraWT_rescue_construct
Plasmid#190609PurposePuromycin-selectable expression of Dora (CG34401) in Drosophila S2 cellsDepositorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiUniversal-Puro
Plasmid#127749PurposeLentiviral plasmid for expressing any U6 driven transcripts (sgRNAs, crRNAs, shRNAs and etc...)DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_1-MS2-Puro
Plasmid#192673PurposeLentiviral expression of sgRNA targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNA #1 (MYOD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLQ-KO-tgt50
Plasmid#126578PurposeCRISPR-Cas9 based efficient genome editing in S. aureusDepositorInsertCas9-Pxyltet-sgRNA-Pspac-donor-tgt50
UseCRISPRExpressionBacterialAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUB-Cas9-@GL1
Plasmid#86779PurposeDisruption of GLABROUS1 gene in Arabidopsis using CRISPR/Cas9DepositorInsertsgRNA against GLABROUS1
UseSynthetic BiologyExpressionPlantPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUF-AsCpf1-pre-gRNA
Plasmid#137849PurposeAsCpf1 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorInsertAsCpf1 and pre-gRNA cassette
UseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUF-LbCpf1-pre-gRNA
Plasmid#137848PurposeLbCpf1 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorInsertLbCpf1-NLS-FLAG and gRNA cassette
UseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.dTomato
Plasmid#89392PurposeLentiviral CRISPR-Cas9 delivery for sgRNA (hU6), dTomato coexpression, EFS Promoter drivenDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pgRNAtet-phaZ
Plasmid#169874PurposeSingle guide RNA plasmid for Cas9 targeting phaZ in P. putidaDepositorInsertsgRNA towards phaZ in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNAkan-glpR
Plasmid#169873PurposeSingle guide RNA plasmid for Cas9 targeting glpR in P. putidaDepositorInsertsgRNA towards glpR in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-mir144 EF1Alpha-puro-T2A-BFP
Plasmid#164791PurposeExpress miR-144 under the U6 promoter in mammalian cellsDepositorInsertsUseLentiviralExpressionMammalianPromoterEF1Alpha and U6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
KA2601_eSpCas9-G2P
Plasmid#124203PurposeExpression of eSpCas9(1.1) and sgRNADepositorTypeEmpty backboneExpressionMammalianAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG_GI4
Plasmid#111595PurposeGI Library VectorDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNOC-CRISPR
Plasmid#100008PurposeExpresses Cas9-Nlux and sgRNA in Nannochloropsis oceanica, contains hygromycin resistance cassette, for integration into genomeDepositorTypeEmpty backboneUseAlgae, nannochloropsis expressionTagsCas9-NluxPromoterRibi promoterAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lsg-LRRK2-1
Plasmid#199277Purposenicking sgRNA to induce LRRK2 (c. 6055 G > A) mutation using PE3DepositorInsertLRRK2 nick
ExpressionMammalianAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.PAC
Plasmid#89393PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), PAC (Puromycin resistance) coexpression, EFS Promoter drivenDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only