We narrowed to 16,266 results for: grn
-
Plasmid#104046PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pSECB sgMTHFD2L_1
Plasmid#106306PurposeExpress Cas9 and sgRNA targeting MTHFD2LDepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSECB sgMTHFD2L_2
Plasmid#106307PurposeExpress Cas9 and sgRNA targeting MTHFD2LDepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPG_1
Plasmid#86344PurposeEncodes gRNA for 3' target of human CEBPGDepositorInsertgRNA against CEBPG (CEBPG Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPA_2
Plasmid#86359PurposeEncodes gRNA for 3' target of human CEBPADepositorInsertgRNA against CEBPA (CEBPA Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAT-9222
Plasmid#124222PurposeCloning plasmid for EGxFP assay with self-targeting gRNA-sDepositorInsertself-targeting gRNA between EGFP halves
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_MED13_iso1_1
Plasmid#135751PurposeEncodes gRNA for 3' target of human MED13_iso1DepositorAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPG_2
Plasmid#86345PurposeEncodes gRNA for 3' target of human CEBPGDepositorInsertgRNA against CEBPG (CEBPG Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgSORCS2-G2
Plasmid#118416PurposeCRISPR knockout, expresses Cas9, and sgRNA targeting Human SORCS2DepositorInsertgRNA SORCS2 Human (SORCS2 Human)
UseCRISPR and LentiviralAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_GATAD1_2
Plasmid#104043PurposeEncodes gRNA for 3' target of human GATAD1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_GATAD1_1
Plasmid#104042PurposeEncodes gRNA for 3' target of human GATAD1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP010
Plasmid#101166PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRCA376 - pBA904 Puro-T2A-GFP NTC guide (pRCA360 backbone)
Plasmid#238167PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsGFPAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-tevopreq1-FXR1-G266E
Plasmid#225482PurposeExpress epegRNA for FXR1DepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CHyMErA_U6(SpCas9_I-SceI)-(AsCas12_PacI)_PGK-puro
Plasmid#189634PurposeLentiviral expression of single SpCas9 and AsCas12a gRNAs for generating combinatorial CHyMErA 3Cs librariesDepositorInserthU6 Cas9-Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEPQDKN0760
Plasmid#185629PurposeModified tobacco rattle virus RNA2 vector expressing an sgRNA fused to trucated flowering locus T (BsaI-domesticated) which targets phytoene desaturase (PDS) of Nicotiana benthamianaDepositorInsertsgRNA
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_COX4
Plasmid#177983Purposelentiviral vector expressing Cas9 and a sgRNA targeting COX4DepositorInsertsgRNA targeting COX4
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only