We narrowed to 60,551 results for: Gene
-
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3034(X-3 MarkerFree)
Plasmid#73272PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site X-3 (Chr X: 223616..224744)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB3039(XII-2 MarkerFree)
Plasmid#73279PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XII-2 (Chr XII: 808805..809939)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKG03428_pLentiX1-(TRE-TagBFP-bGH)-EF1alpha-mRuby2-bGH
Plasmid#252553PurposeInducible gene and constitutive reporter with divergent syntax, lentiviral vectorDepositorInsertmRuby2
UseLentiviralExpressionMammalianPromoterhEF1a (human elongation factor 1-alpha), TRE3GAvailable SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
JD94
Plasmid#229479PurposeCMV promoter driving expression of adenoviral E2A geneDepositorInsertE2A
UseAAV and AdenoviralExpressionMammalianPromoterCMVAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
JD80
Plasmid#229480PurposeAdenoviral VA RNA I geneDepositorInsertVA RNA I
UseAAV and AdenoviralExpressionMammalianPromoterwt promoterAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBA333
Plasmid#214745PurposeMedium copy thyA-infA plasmid containing gfp and no antibiotic resistance gene (ARG)DepositorInsertBBa_J23119-RiboJ-RBS(21992)-gfpmut3
ExpressionBacterialAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pILGFP3AG4ARSd
Plasmid#185876PurposeA plasmid without an ARS sequence for in vivo gene amplification (HapAmp) at RPL25 locus (~12 copy)DepositorTypeEmpty backboneExpressionYeastMutationNoneAvailable SinceSept. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pINER5
Plasmid#185895PurposeIn vivo gene amplification (HapAmp) of nerolidol synthetic module at RPL25 locus (15 copy).DepositorInsertPRPL25(Arm1)>Kl.LEU2>TKl.LEU2-PGAL1>ERG20>TRPL3-TRPL25(Arm3)-ARS305-PSk.GAL2>YFAST-EVBR1.2A-AcNES1>TRPL41B-PPDA1>RPL25(part;Arm2
ExpressionYeastMutationNoneAvailable SinceAug. 25, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pML104-kanR1136
Plasmid#162040PurposeExpresses Cas9 and contains kanR1136 guide which targets the kanR geneDepositorInsertkanR1136 guide
UseCRISPRExpressionYeastAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAGM55361
Plasmid#153227PurposeControl plasmid for knockout of AP3 geneDepositorInsertCas9, guide RNA for AP3 and FAST marker
UseSynthetic BiologyAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-P32
Plasmid#120043PurposeTemplate for C-terminal PCR tagging of mammalian genes (Puromycin selection) with S-TagDepositorInsertS-Tag
UsePcr templateTagsS-TagPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-29
Plasmid#120008PurposeTemplate for C-terminal PCR tagging of mammalian genes (without selection) with Strep-IIDepositorInsertStrep-II
UsePcr templateTagsStrep-IIPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZH519
Plasmid#102672PurposeTetracycline inducible expression of GFPmut2 using autoregulation; moderate ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assemblyDepositorInsertGFPmut2
ExpressionBacterialAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZH522
Plasmid#102675PurposeTetracycline inducible expression of GFPmut2 with constitutive TetR; moderate ribosome binding site; GFPmut2 ORF can be replaced with gene of interest by isothermal assemblyDepositorInsertGFPmut2
ExpressionBacterialAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPMVAd36
Plasmid#98302PurposeEnhancing the lower-part mevalonate pathway; overexpressing yeast mevalonate pathway genes under the control of consitutive promoters or CUP1 promoter.DepositorInsertPCUP1>ERG12>TNAT5-PTEF2>ERG8>TIDP1-TIDP1ExpressionYeastAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCaRNA3-eIFiso4E120(+)
Plasmid#86092PurposeThis vector is used to specifically silence the eIF(iso)4E gene in peach via VIGS.DepositorInserteIFiso4E
ExpressionPlantAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBW216J106-Amp32C
Plasmid#78651PurposepSB3K3 carrying J106-30hrpR-32hrpS-t-hrpL-30gfp-tTDepositorInsertJ106-30hrpR-32hrpS-t-hrpL-30gfp-t
UseSynthetic BiologyPromotersee insertAvailable SinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBALU12
Plasmid#69328PurposeEncodes a recombineering cassette for tagging a target gene within a genomic clone with a fluorescent protein. Cassette: bicistronic; FRT-galK-FRT in 2nd mChO intron;use C-term after STOPDepositorInsertgSL2-NLS-mChOint-FgF
ExpressionBacterialAvailable SinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
Pr2-T7RNAP
Plasmid#67739PurposeOR2-OR1-P2 promoter expressing T7 RNAPDepositorInsertUTR1-T7RNAP-T500
UseSynthetic BiologyExpressionBacterialPromoterOR2-OR1-Pr2Available SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Pr2-deGFP-MGapt
Plasmid#67736PurposeOR2-OR1-Pr2 promoter expressing deGFP-MG aptamer fusionDepositorInsertUTR1-deGFP-MGapt-T500
UseSynthetic BiologyExpressionBacterialPromoterOR2-OR1-Pr2Available SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Pr1-deGFP-MGapt
Plasmid#67735PurposeOR2-OR1-Pr1 promoter expressing deGFP-MG aptamer fusionDepositorInsertUTR1-deGFP-MGapt-T500
UseSynthetic BiologyExpressionBacterialPromoterOR2-OR1-Pr1Available SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
SNV-gfp-IRES-MCS
Plasmid#53122PurposeRetrovirus vector backbone that co-expresses GFP and a gene of interest, driven by the Spleen Necrosis Virus promoter; for use in chicken cellsDepositorTypeEmpty backboneUseRetroviral; For expression in chicken cellsTagsEGFP-IRESPromoterSNV (spleen necrosis virus)Available SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJQ200mp19
Plasmid#78501PurposeSuicide vector for allelic exchangeDepositorTypeEmpty backboneUseSuicide vector for gene replacementPromoternoneAvailable SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIVT-eeBxb1
Plasmid#232748PurposeIVT template for making modRNA encoding eeBxb1DepositorInsertBxb1
UseIn vitro transcriptionTagsHA and SV40 NLSMutationV74A, E229K, V375IAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_Hinge Notch SNIPR (HNF1A, ALPPL2 scFv)
Plasmid#188385PurposeLentiviral vector - constitutive expression of an anti-ALPPL2 SNIPR with a CD8alpha-variant2-ECD, a Notch1-TMD, a Notch2-JMD, and a HNF1A(DBD)-p65(361-551) transcriptional factorDepositorInsertPGK_antiALPPL2_CD8alpha-variant2-ECD_Notch1-TMD_Notch2-JMD_HNF1A(DBD)-p65(361-551)
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hif-1-sgRNA-A
Plasmid#177784PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hif-1 promoter)DepositorInserthif-1 (hif-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
HIV-dual-GT
Plasmid#122696PurposeDual-fluorescence reporter to monitor the expression of HIV-1 early genes and late genes simultaneously.DepositorInsertsmTagBFP2
DsRed-max
UseLentiviralTagsPEST domainPromoterHIV-1 LTRAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9
Plasmid#162162PurposeExpresses hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTagsN/AExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only