167,808 results
-
Plasmid#242234PurposeExpresses alpha synuclein (missing exon 3, residues 41-54) in bacteriaDepositorInsertasyn(Δ41-54)
TagsnoneExpressionBacterialMutationdeleted amino acids 41-54Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP13787 - pAAV-AiE0140h_3xC2-minBG-iCre(R297T)-BGHpA (Alias: CN3787)
Plasmid#230468PurposeAiE0140h_3xC2 is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertiCre(R297T)
UseAAVPromoterminBGAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-DDX10-KS
Plasmid#237644PurposeFor overexpression of mEGFP-NUP98-DDX10-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-MTS-TFAM-V5
Plasmid#200813Purposeexpresses MTS-TFAM in mammalian cellsDepositorAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloTag-LacI-KRAB
Plasmid#232638Purposelac repressor (LacI) which binds lacO sites; labeled with HaloTag and coupled with Krüppel-associated box (KRAB) repressorDepositorInsertHaloTag-LacI-KRAB
TagsNLSExpressionMammalianMutationnonePromoterCMVAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP15080 - pAAV-AiE0724m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN5080)
Plasmid#229930PurposeAiE0724m_3xC2 is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific brain cell typesDepositorInsertSYFP2
UseAAVAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-RARG
Plasmid#222570PurposePiggyBac transposon plasmid for doxycycline inducible expression of RARGDepositorInsertRARG (RARG Human)
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmiRFP670-C1-Nir1-LNS2
Plasmid#220085Purposehigh affinity PA biosensor with far-red fluorophoreDepositorInsertPITPNM3 (PITPNM3 Human)
TagsiRFP670-GGSGGMExpressionMammalianMutationamino acids 613-897PromoterCMVAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
SGLT2(GFP)-MAP17(nb)
Plasmid#216211Purposefor expression of human GFP-tagged SGLT2-MAP17 nanobody complex in BacMam systemDepositorTagsGFPExpressionMammalianAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/XBB.1.5
Plasmid#212991Purpose"Mammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.5 variantDepositorInsertpαH-S-GSAS/XBB.1.5 (S )
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutation(T19I,Del24/26,A27S,V83A,G142D,Del144,H146Q,Q183E…PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDB2-hPER1-Luciferase-CD4-bla
Plasmid#189981PurposeDonor Vector to integrate firefly Luciferase C-terminal into the human PER1 Locus to express it as a fusion proteinDepositorInsertLuciferase
UseCRISPRTags3xFlagAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E_afp_UTR
Plasmid#199341PurposepAMS448; Gateway 3' entry clone encoding ocean pout antifreeze (afp) protein 3'UTRDepositorInsertafp 3' UTR
UseGateway donor vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mCsnk2b - 1
Plasmid#198505Purposelentiviral stable expression of mCsnk2b gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mAtp5c-2
Plasmid#198480Purposelentiviral stable expression of mAtp5c gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mCert1-1
Plasmid#198487Purposelentiviral stable expression of mCert1 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mSptlc2 - 2
Plasmid#198494Purposelentiviral stable expression of mSptlc2 gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mPHB2-1
Plasmid#198483Purposelentiviral stable expression of mPHB2 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mHgs-2
Plasmid#198482Purposelentiviral stable expression of mHgs gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mCct8 - 1
Plasmid#198503Purposelentiviral stable expression of mCct8 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MS2-HA-HsRoquin2_AE
Plasmid#148614PurposeMammalian Expression of HsRoquin2DepositorInsertHsRoquin2 (RC3H2 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Hic1 GFP
Plasmid#106953PurposeLentivirus encoding sgRNA targeting murine Hic1. Includes GFP marker.DepositorInsertanti-Hic1 sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET30-T7-lacO-His-sfGFP
Plasmid#180754PurposepET30 vector with sfGFP-S-tag inserted between the Bgl II and T7 terminatorDepositorInsertsuperfolder green fluorescent protein
Tagsstrep tagExpressionBacterialMutationG140C- Please see depositor commentsAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC29A2_STOP
Plasmid#161305PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC29A2 (SLC29A2 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIGc-Xph20
Plasmid#133024PurposeExpresses Xph20 in bacteriaDepositorInsertXph20
TagsHis10ExpressionBacterialMutationS63KPromoterT7Available SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA2896_pPB-TREtight-Tkmin-cHA-IRESH2BmKO2
Plasmid#124175PurposepiggyBac-based Dox-inducible expression (very weak)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA2895_pPB-TREtight-TATAmin-cHA-IRESH2BmKO2
Plasmid#124174PurposepiggyBac-based Dox-inducible expression (weak)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry (AAV9)
Viral Prep#44361-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiCRISPRv2 (Lentiviral Prep)
Viral Prep#73179-LVPurposeReady-to-use Lentiviral Prep particles produced from Human sgRNA library Brunello in lentiCRISPRv2 (#73179). In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2 plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR screening in human cells. This backbone contains SpCas9 and unique gRNAs, and can be used to make edits across 19,114 genes in the human genome. In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2.DepositorAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8m-WPRE (AAV1)
Viral Prep#162375-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP8m-WPRE (#162375). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8m-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only