We narrowed to 8,754 results for: reporter
-
Plasmid#51934Purposeluciferase reporter for rat alpha-MHC promoterDepositorInsertalpha MHC (Myh6 Rat)
UseLuciferaseTagsluciferaseMutation-2930 to +410 promoter regionPromoteralpha MHCAvailable SinceMay 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
K-SPOTIT1.0
Plasmid#171215PurposeExpresses a kappa-opioid receptor-based circular permuted green fluorescent protein sensorDepositorInsertK-SPOTIT1.0
UseLentiviralTagsFLAG tagExpressionMammalianPromoterCMVAvailable SinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCl-MCS_miniCMV_EGFP
Plasmid#134984PurposeThe plasmid includes a EGFP gene driven by a minimal CMV promoter. Cis-regulatory elements can be cloned into the single EcoRV site. This plasmid can be used for generating a lentiviral vectorDepositorInsertEGFP
UseLentiviralPromoterminCMVAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAG-SaCas9-WPRE
Plasmid#89996PurposeExpresses high levels of WT SaCas9 for genome editingDepositorInsertSaCas9 (NEWENTRY Staphylococcus aureus)
Tags3xHA, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianPromoterCAGAvailable SinceSept. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLibacceptorV2
Plasmid#106250PurposeRecombination-mediated cassette exchange with target genomic lociDepositorTypeEmpty backboneUseCre/Lox and Synthetic BiologyExpressionBacterialAvailable SinceNov. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
GCaMP-AMPK-SPARK
Plasmid#226257PurposeDual reporter of Ca2+ levels and AMPK activityDepositorInsertGCaMP-AMPK-SPARK
ExpressionMammalianAvailable SinceOct. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-ZIKVA-GFP-puro
Plasmid#140090PurposeFluorescence activatable reporter of ZIKV NS2B-NS3 protease activityDepositorInsertZIKVA-GFP
UseLentiviral; Low expressionTags6XHis tag and GFPExpressionMammalianPromoterCMVAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTXTL-T7max-RLuc
Plasmid#188312PurposeExpression of Renilla luciferase via a T7 promoter in TXTLDepositorInsertRenilla luciferase
UseLuciferase and Synthetic BiologyTags8x His-tagExpressionBacterialPromoterT7MaxAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG504-frFAST
Plasmid#160055PurposeExpresses frFAST in mammalian cellsDepositorInsertfrFAST
ExpressionMammalianAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.MCS.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
Plasmid#169283PurposeDoxycycline-inducible overexpression of cDNA with dTomato as a reporter fluorescent proteinDepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKL2351
Plasmid#199721PurposeA pVS1-based T-DNA binary vector and destination vector for Gateway cloning.DepositorInsertNPTII
ExpressionPlantAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pattB-nsyb-MKII::nlsLexADBDo
Plasmid#64725Purposegenerating transgenic TRIC fliesDepositorInsertMKII::nlsLexADBDo
ExpressionInsectAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pattB-nsyb-M13::GAL4DBDo
Plasmid#64720Purposegenerating transgenic TRIC fliesDepositorInsertM13::GAL4DBDo
ExpressionInsectAvailable SinceMay 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPT24-mtnluc
Plasmid#184339PurposeTransformation of mitochondrial DNA in yeastDepositorInsertnanoluciferase recoded for mitochondrial expression flanked by COX2 UTRs
ExpressionYeastAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAMS366-4xCDRE-GFP
Plasmid#138657Purposestable GFP reporter to monitor calcineurin activity via calcineurin-dependent response element (CDRE) in S. cerevisiaeDepositorInsert4xCDRE-CYC1(PM)-yeGFP
UseYeast reporter plasmidPromoterCYC1Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC4EN-F1-GAFm
Plasmid#39870DepositorInsertiRFP protein GAF domain (mutated)
TagsFKBPExpressionMammalianMutationF165Y, D232Y, W308RPromoterCMVAvailable SinceJuly 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
NGN3-T2A-NLS-tdTomato-ires-puro-BGHpA-PGK-puro
Plasmid#89994PurposeDonor template for generation of NGN3-ntdTomato reporter cell linesDepositorAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Nuc-ExRai-AMPKAR
Plasmid#192450PurposeExRai-AMPKAR targeted to the nucleus.DepositorInsertExRai-AMPKAR-NLS
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hSyn1-mRuby2-T2A-GCaMP6f
Plasmid#197595PurposeLentiviral transfer vector for the neuronal expression of mRuby2-T2A-GCaMP6f (fluorescent reporter for Calcium imaging)DepositorInsertmRuby2-T2A-GCaMP6f
UseLentiviralPromoterhSynIAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Donor_eGP2AP_RC
Plasmid#133784PurposeLibrary reporter vector/integration vector. Contains library cloning sites MluI and SpeI upstream of a terminator and downstream of a BxB1 attB site. Library integration occurs through BxB1 site.DepositorTypeEmpty backboneTagseGFP-P2A-PuroExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-H-RAN-GFP1
Plasmid#106418PurposeH-RAN-GFP1 (RANbody GFP1::Sm-HAtag)DepositorInsertH-RAN-GFP1
TagsHA, His, and Multiple HAExpressionMammalianAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSplit-OC-U5-40K
Plasmid#51741PurposeExpress U5-40K-LucC fusion protein in mammalian cellsDepositorInsertU5-40K (SNRNP40 Human)
TagsFLAG and Luciferase (394-550aa)ExpressionMammalianPromoterCMVAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRU1101
Plasmid#14466DepositorInsertunstable gfp-mut3.1 ASV
ExpressionBacterialAvailable SinceApril 23, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSCMV-H2B-FT-Slow
Plasmid#157671PurposeRetroviral vector for expressing chimeric human histone H2B fused with the "Slow" variant of the monomeric color-changing fluorescent timer (FT) in mammalian cells.DepositorInsertHistone H2B
UseRetroviralTagsSlow-FTExpressionMammalianPromoterCMVAvailable SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-TRKB-V5/HIS
Plasmid#205614PurposeExpression of human TRKB receptor tyrosine kinase in mammalian cellsDepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AXL-V5/HIS
Plasmid#200117PurposeExpression of human AXL receptor tyrosine kinase in mammalian cellsDepositorAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-INSR-V5/HIS
Plasmid#201980Purposeexpression of human INSR receptor tyrosine kinase in mammalian cellsDepositorAvailable SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FGFR2c-V5/HIS
Plasmid#201107Purposeexpression of human FGFR2 receptor tyrosine kinase in mammalian cellsDepositorInserthuman FGFR2 receptor tyrosine kinase, variant c, full length, wildtype (FGFR2 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNH082
Plasmid#42165DepositorInsertmTFP1
ExpressionWormAvailable SinceFeb. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S3-ExRaiAKAR
Plasmid#160724PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains GFP-based fluorescent reporter ExRai-AKAR (PKA indicator), V5 tag, and S3 protein scaffold.DepositorInsertS3-ExRaiAKAR
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PCDNA3-FlipGFP(Caspase-1 cleavage seq) T2A mCherry
Plasmid#124494PurposeExpresses FlipGFP (caspase-1 cleavage sequence) and T2A mCherryDepositorInsertFlipGFP(Caspase-1 cleavage seq) T2A mCherry
UseSynthetic BiologyAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXRDRE-puro
Plasmid#31270DepositorInsertXRDRE
ExpressionMammalianAvailable SinceSept. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(2xD-E_inD)Luc
Plasmid#200109PurposeLuciferase reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertmodified EGR1 promoter
ExpressionMammalianMutationhighly modified sequencePromoter2 copies of D-E element in front of EGR1 promoter…Available SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(2xD-E)dTomato
Plasmid#200110PurposeFluorescent reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertmodified EGR1 promoter
ExpressionMammalianMutationhighly modified sequencePromoter2 copies of D-E element, no other promoter elemen…Available SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapErk)DsRed
Plasmid#200114PurposeFluorescent reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertMapErk sequence in minimal promoter
ExpressionMammalianMutationhighly modified sequencePromoter5 copies of designed MapErk sequence, no other pr…Available SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCTCON2-GFP-TAG
Plasmid#158131PurposeSingle fluorescent protein reporter (GFP) for ncAA incorporation (TAG construct)DepositorInsertsfGFP
ExpressionYeastMutationIntroduced a stop codon in place of the tyrosine …PromoterGAL1-10Available SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
ARTi
Plasmid#214064PurposeFluorescent reporter system to measure EJC-enhanced NMD activity. No intron in 5'UTRDepositorInsertTurboRFP
ExpressionMammalianMutationLinker sequence present between RFP and GFPAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR-USR-eGFP
Plasmid#208830PurposeHDR Universal Surrogate Reporter with a sgRNA and consistently expressed eGFP but without Cas9. The selective PuroR reporter gene was designed to be repaired only by the sgRNA/Cas9-triggered HDR.DepositorTypeEmpty backboneExpressionMammalianPromoterCMV, U6Available SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CaMKIIa-mTagBFP2
Plasmid#87254PurposeLentiviral fluorescent reporter using the neuronal cell type-specific promoter of the CaM Kinase II alpha gene.DepositorInsertmTagBFP2
UseLentiviralTags6xHisPromoterCaMKIIaAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
hMYOG-3xHA-IRES-hrGFP (#324)
Plasmid#78341PurposeOverexpression of human MYOG ORF with a 3xHA C-terminal tag and an IRES-hrGFP reporterDepositorAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE mCherry-Rab11A S25N
Plasmid#228037PurposeMammalian lentiviral expression of mCherry-labeled Rab11 S25N (dominant negative mutation).DepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SEP-Nanoluc-cyOFP1
Plasmid#141082Purposeprototype of the bioluminescent reporter pHLuc, for detecting extracellular pH changes in tumor acidosisDepositorInsertSEP-Nanoluc-cyOFP1
UseLentiviralMutationDeletion of amino acids DISGG from positions 673 …PromoterEF1αAvailable SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCYC1pr-GNSI (LEU)
Plasmid#111450PurposeGNSI is a synthetic, genetically-encoded reporter that allows rapid plate-based assessment of AP-3 functional deficiency, using either colorimetric or growth phenotype readouts.DepositorInsertsCYC1 Promoter (CYC1 Budding Yeast)
Nyv1 Cytosolic Domain (aa 6-230)
Snc1 Transmembrane Domain (TMD)
SUC2 CDS
SUC2 terminator
TagsmGFP5ExpressionYeastMutationM109I (Naturally occurring SNP) and The first 21 …Available SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG-Cas9
Plasmid#89995PurposeExpresses high levels of WT Cas9 for genome editingDepositorInserthCas9
Tags3xFlag, SV40 NLS, and T2A peptideExpressionMammalianPromoterCAGAvailable SinceJune 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNHEJ-RPG
Plasmid#85931PurposeConstitutively express DsRed and conditionally express Puro and EGFP. Used to test transfection efficiency and enrich genetically modified cellsDepositorInsertpPB-CMV-DsRed-polyA-CAG-NHEJ. Puro-T2A-EGFP
UseDual-reporter surrogateExpressionMammalianAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
BII-TOP-tdT
Plasmid#133395PurposePiggybac vector for canonical Wnt signaling reporterDepositorInserttdTomato-NLS
ExpressionMammalianMutationN/APromoterSuperTOPFlashAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CSF1R-V5/HIS
Plasmid#201984Purposeexpression of human CSF1R receptor tyrosine kinase in mammalian cellsDepositorInsertCSF1R receptor tyrosine kinase (CSF1R Human)
TagsV5, 6xHisExpressionMammalianPromoterCMVAvailable SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-V5/HIS
Plasmid#201987Purposeexpression of human PDGFRA receptor tyrosine kinase in mammalian cellsDepositorInsertPDGFRA receptor tyrosine kinase (PDGFRA Human)
TagsV5, 6xHisExpressionMammalianPromoterCMVAvailable SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHDE_PR1::RUBY
Plasmid#255430PurposePathogen-inducible PR1 promoter driving the non-invasive RUBY reporter geneDepositorInsertPR1 promoter from Arabidopsis thaliana Col-0
ExpressionPlantAvailable SinceMay 12, 2026AvailabilityAcademic Institutions and Nonprofits only