We narrowed to 28,194 results for: sta
-
Plasmid#73971PurposeSTAG2 cDNA (CCDS43990) V181MDepositorAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pCMV-FLAG-WRAP53beta-siRNA-resistant
Plasmid#64680Purposeexpresses siRNA resistant WRAP53betaDepositorInsertWD40-encoding RNA antisense to P53 (WRAP53 Human)
TagsFLAGExpressionMammalianMutationsiRNA resistantPromoterCMVAvailable SinceMay 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBACgus_Sumostar/LRRK2 1867-2186_C2024S/C2025S
Plasmid#40388DepositorInsertsUseBaculovirusTags6xHis and HisTEVMutationaa1867-2186, C2024S/C2025SPromoterpolHAvailable SinceOct. 1, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
Tol2 8xSTAR-sTomato-NLS. PGK-puro
Plasmid#136261PurposeFluorescent reporter for intestinal stem cells through ASCL2 transcriptional activityDepositorInsertstem cell Ascl2 reporter, 8 repeats
UseTol2 transposaseTagssTomato-NLSExpressionMammalianAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_OAS3
Plasmid#99324PurposeLuciferase validation vector with OAS3 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr12: 94575894 -94578286
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_ISG15
Plasmid#99322PurposeLuciferase validation vector with ISG15 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr1: 947976 -949995 (ISG15 Human)
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-scFv-GCN4-mStayGold-GB1-dWPRE
Plasmid#231598PurposeExpress scFv_GCN4-mStayGold for SunTag translation imagingDepositorInsertscFv-GCN4-mStayGold
UseLentiviralAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant SigmaR1-mNeonGreen R119A F191A
Plasmid#226574PurposeEncodes mutant siRNA resistant SigmaR1 protein (substitutions) labeled with mNeonGreenDepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
TagsmNeonGreenExpressionMammalianMutationR119A, F191AAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2 8xSTAR-mNeonGreen-NLS. PGK-puro
Plasmid#136262PurposeFluorescent reporter for intestinal stem cells through ASCL2 transcriptional activityDepositorInsertstem cell Ascl2 reporter, 8 repeats
UseTol2 transposaseTagsmNeonGreen-NLSExpressionMammalianAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant ss-SigmaR1DTM-mNeonGreen R119A F191A
Plasmid#226576PurposeEncodes mutant siRNA resistant SigmaR1 protein (transmembrane region deletion + substitutions) labeled with mNeonGreenDepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
TagsmNeonGreenExpressionMammalianMutationR119A, F191AAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2 8xSTAR-mScarletI-NLS. PGK-puro
Plasmid#136263PurposeFluorescent reporter for intestinal stem cells through ASCL2 transcriptional activityDepositorInsertstem cell Ascl2 reporter, 8 repeats
UseTol2 transposaseTagsmScarletI-NLSExpressionMammalianAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEM237 - pEXP[Prpl-3 | histamine | rpl-3 UTR]
Plasmid#159796PurposeHistamine based negative selection marker to paralyze animals with arraysDepositorInsertpEXP[Prpl-3 | histamine | rpl-3 UTR]
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish aBb crystallin 2kb promoter/AcGFP
Plasmid#98099PurposeZebrafish aBb crystallin 2kb promoter segment driving GFP expressionDepositorInsertAlpha Bb-crystallin promoter 2 kb fragment, Danio rerio (cryabb Zebrafish)
UseGfp expressingTagsGFPPromoterDanio alpha Bb-crystallin 2 kb fragment (-2092/-1)Available SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2 stabilized mutant Beta Catenin-GFP
Plasmid#29684DepositorAvailable SinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
Stat1 alpha Y701F Flag pRc/CMV
Plasmid#8702DepositorAvailable SinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_MX1
Plasmid#99323PurposeLuciferase validation vector with MX1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr21: 42791443 -42793515
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCEP-Puro-TetOn-L1RP-ORF1_StammerAAA_Halo-GFPai
Plasmid#202571PurposeExpresses an endogenous-like L1RP LINE-1 element with a C-terminal HaloTag on the ORF1 protein with the M91A, E92A, and L93A mutations and a GFP retrotransposition reporter (GFP-AI) in the 3' UTRDepositorInsertLINE-1
TagsGFP-AI retrotransposition reporter and HaloTag7 o…ExpressionMammalianMutationChanged ORF1p Methionine 91 to Alanine, ORF1p Glu…Available SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
LO601: pMVP (R4-R3) destabilized firefly luciferase (Luc2P)
Plasmid#132926PurposepMVP R4-R3 entry plasmid, contains destabilized Firefly Luciferase (Luc2P) for 3- or 4-component MultiSite Gateway Pro assemblyDepositorInsertLuc2P
UseLuciferase and Synthetic Biology; Pmvp gateway en…TagsPEST destabilization domainAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only