We narrowed to 1,931 results for: cas9 expression vector
-
Plasmid#165486PurposeVector for expression of the SpCas9 VRKG variant in human cells: CMV-T7-humanVRKG(SpCas9, D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFLAGDepositorInsertMammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
UseCRISPRTags3x FLAG and SV40 NLSExpressionMammalianMutationD1135V, S1136R, D1332K, and R1333G mutations in S…PromoterCMV and T7Available sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGE669
Plasmid#153235PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceOct. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE672
Plasmid#153238PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantMutationPromoterAvailable sinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFD116
Plasmid#124769PurposepFD116 carries dcas9 controlled by an aTc-inducible Ptet promoter, a sgRNA controlled constitutively from PpflB S. aureus promoter to clone a guide between two BsaI sites and oriT on pLZ12 vectorDepositorInsertsPtet
dcas9
PpflB sgRNA BsaI
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
UseTagsExpressionMammalianMutationPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDD143
Plasmid#119880PurposeArabinose inducible dCas9sth1 and constitutive sgRNA on pAL5000/pMB1 backbone with gentamicin resistance.DepositorInsertpBAD_dCas9sth1
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGH044_mCherry
Plasmid#85412Purposelentiviral expression vector for mCherryDepositorInsertmCherry
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGH045_EGFP
Plasmid#85411Purposelentiviral expression vector for GFPDepositorInsertEGFP
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRa_VPR_yl
Plasmid#107677PurposeCRISPR-dCas9-VPR vector for Yarrowia lipolytica, expressing dCas9-VPR and AvrII site for sgRNA insertionDepositorInsertsCodon optimized dCas9-VPR
sgRNA expression cassette
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterSCR1'-tRNA and UAS1B8-TEF(136)Available sinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGH311_wtGFP S65T
Plasmid#85408Purposelentiviral expression vector for wtGFP S65TDepositorInsertwtGFP S65T
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGH312_wtGFP Q80H
Plasmid#85409Purposelentiviral expression vector for wtGFP Q80HDepositorInsertwtGFP Q80H
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-TurboCas-NLS-Blast
Plasmid#232346PurposeLentiviral expression vector for dCas9 fused to miniTurboNLSDepositorInsertdCas9
UseCRISPR and LentiviralTags3xHA, miniTurbo, V5 and 3xSV40 NLSExpressionMammalianMutationPromoterEF1aAvailable sinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH314_wtGFP S65T, Q80H
Plasmid#85407Purposelentiviral expression vector for wtGFP S65T-Q80HDepositorInsertwtGFP S65T, Q80H
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCD185
Plasmid#113317PurposedCas9, MCP-SoxS_R93ADepositorInsertdCas9 and MCP-SoxS_R93A
UseCRISPRTagsExpressionBacterialMutationR93APromoterAvailable sinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCD175
Plasmid#113316PurposedCas9, MCP-AsiA, rpoD_F563YDepositorInsertdCas9, MCP-T4.AsiA, rpoD_F563Y
UseCRISPRTagsExpressionBacterialMutationF563YPromoterAvailable sinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CDK5RAP2-SVA-BFP
Plasmid#202824PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CDK5RAP2 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within CDK5RAP2 gene
UseLentiviralTagsExpressionMammalianMutationPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 KanR foundation lox casette
Plasmid#132388PurposeFoundation cassette containing lox sites for cre-mediated exchange of inducible vectors, confers mammalian G418 resistance, targets AAVS1 locusDepositorInsertG418 resistance
UseCRISPR and Cre/LoxTagsExpressionMammalianMutationPromoterpromoterlessAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-mcherry
Plasmid#202822PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs that delete exon 1 within the ZNF91 gene
UseLentiviralTagsExpressionMammalianMutationPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/mEGFP-1T-IRES-mCherry
Plasmid#190190PurposeLentiviral expression vector with altered Kozak sequence to direct EGFP expression. mCherry expression is regulated by an IRES.DepositorInsertsmEGFP
mCherry
UseLentiviralTagsExpressionMutationchanged EGFP Kozak sequence inserting a C>T mo…PromoterEIF1-shortAvailable sinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-SCN8A-SVA-BFP
Plasmid#202826PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the SCN8A gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within SCN8A gene
UseLentiviralTagsExpressionMammalianMutationPromoterU6 - twoAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-AK057321-SVA-mcherry
Plasmid#202821PurposeLentiviral vector modified to express two sgRNAs that delete the SVA within the SVA-lncRNA AK057321 gene (exon 3) with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within SVA-lncRNA AK057321 gene
UseLentiviralTagsExpressionMammalianMutationPromoterU6 (two)Available sinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CHAF1B-SVA-BFP
Plasmid#202825PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CHAF1B gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within CHAF1B gene
UseLentiviralTagsExpressionMammalianMutationPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralTagsExpressionMammalianMutationPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2GFP
Plasmid#82416Purpose3rd generation lentiviral vector expressing GFP alongside Cas9 and an sgRNA cloning siteDepositorInsertGFP
UseCRISPR and LentiviralTagsExpressionMutationPromoterEFS (P2A)Available sinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-E
Plasmid#78852PurposeIntroduce sgRNA into a lentiviral vector (LentiCRISPR V2) which contains eSpCas9 and puromycin cassetteDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsCas9-P2A-PuroExpressionMammalianMutationPromoterAvailable sinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_D11 (pAVA3773)
Plasmid#239310PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and a non-targeting sgRNA as control(-)DepositorInsertU6-driven non-targeting sgRNA Control(-)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-SOS1(dog)-gRNA1
Plasmid#228755PurposeA knockout vector for dog SOS1.DepositorInsertA gRNA targeting the dog SOS1 gene and the cDNA of CRISPR-Cas9 (SOS1 canis lupus)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-SOS1(dog)-gRNA2
Plasmid#228756PurposeA knockout vector for dog SOS1.DepositorInsertA gRNA targeting the dog SOS1 gene and the cDNA of CRISPR-Cas9 (SOS1 canis lupus)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-Csy4
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
UseTagsExpressionPlantMutationPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
UseTagsExpressionPlantMutationPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only