We narrowed to 16,416 results for: GRN;
-
Plasmid#177249PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses Cebpd gRNADepositorInsertsgCebpd_1st
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-scrambled
Plasmid#183455PurposeThis control vector contains a scrambled version of the targeting sequence used in the pFUGW-shRIIα constructDepositorInsertscrambled sgRNA
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
1098E=TI-pgSIT[tra,bTub,Hasp70Bb-Cas9]
Plasmid#149427PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes, and Hsp70Bb-Cas9-T2A-eGFP-p10.DepositorInsertsU6.3-gRNAs[TraB, bTub]
Hsp70Bb-Cas9-T2A-eGFP-p10
UseCRISPRTagseGFPExpressionInsectAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA1-gltA2
Plasmid#71348PurposegltA1-gltA2 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Ptgfr
Plasmid#170303PurposeA knock-out vector for the mouse PtgfrDepositorInsertA gRNA targeting the mouse Ptgfr gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgAAT Nicking
Plasmid#169842PurposeExpress a nicking sgRNA used for correction (via A•T-to-G•C) of the E342K mutationDepositorInsertsgAAT Nicking (SERPINA1 Human)
ExpressionMammalianAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
THI ONLY pALD4 T-
Plasmid#161497PurposeNon activation and non targeting control for CRISPR/RNA scaffold based transcription regulation in Pichia pastoris BB3rN_pTEF2_dCAS9(3xFLAG_SV40NLS)_pPOR1_MS2bind_VP64_SV40NLS_pGAP_THI11_T-_gRNA_MS2DepositorInsertsdCAS9
MS2 (non activation control NAC)
gRNA (Non targeting control NTC)
ExpressionYeastPromoterpALD4, pPOR1, and pTEF2Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT-9251
Plasmid#124226PurposeBacterial SpCas9-HF1 expressionDepositorInsertSpCas9-HF1
UseCRISPRExpressionBacterialPromoterTetR/TetAAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pFA0057
Plasmid#131784PurposeGuide RNA (gGFP) and Cas9 expression plasmid for cleaving pFA6 series GFP C-terminal tagging cassettes, including GFP-His3MX6. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer GFP cassette guide (gGFP) and 5' sgRNA
ExpressionBacterial and YeastAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJOG252
Plasmid#80584Purposerecipient plasmid [single activator]; p35S:Cas9 D10A/N863A-Hax3CT, nptIIDepositorInsertspnos:nptII-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
pAtU6-BpiI-ccdB_CmR-BpiI_sgRNA_scaffold
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJOG253
Plasmid#80585Purposerecipient plasmid [single activator]; p35S:Cas9 D10A/N863A-Hax3CT, BASTADepositorInsertspnos:PAT-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
pAtU6-BpiI-ccdB_CmR-BpiI_sgRNA_scaffold
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCryptDel4.8
Plasmid#141293PurposePlasmid for curing pMUT2 in one step based on pFREE. Contains RelB antitoxin, as well as gRNA targetting pMUT2 plasmid as well as pCryptDel4.8 itself.DepositorInsertsRelB
gRNA targetting pMUT2
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterNative promoter from pMUT2 relB/relE operon and P…Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2GFP
Plasmid#82416Purpose3rd generation lentiviral vector expressing GFP alongside Cas9 and an sgRNA cloning siteDepositorInsertGFP
UseCRISPR and LentiviralPromoterEFS (P2A)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX601-GFP
Plasmid#84040PurposeStaphylococcus aureus (SaCas9) conjugated with GFPDepositorInsertSaCas9
UseAAV and CRISPRTagsNLS and T2A-EGFPExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a6
Plasmid#124847PurposeMutagenesis of Slc17a6 with SauCas9DepositorInsertSlc17a6 gRNA (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-hfCas13d-pa
Plasmid#233036PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-ABE N-terminal
Plasmid#137177PurposeAAV genome: expresses the N-terminal of v5 AAV-ABE from the Cbh promoterDepositorInsertv5 AAV-ABE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable SinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PE2max-∆RNaseH-dualU6
Plasmid#198735PurposeAAV genome encoding C-terminal PE2max and U6 expression cassettesDepositorInsertNpuC-CtermPE2max∆RNaseH
UseAAVPromoterCbhAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only