We narrowed to 17,135 results for: sgrna
-
Plasmid#133341Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets gcrA gene's promoter on the template strand in Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA(MS2)_MCP-KRAB-IRES-zsGreen1
Plasmid#138460Purposelenti sgRNA cloning backbone with MS2 loops and EF1a-MCP-KRABDepositorInsertMCP-KRAB-IRES-zsGreen1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1AAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA(MS2)_MCP-VP64-IRES-zsGreen1
Plasmid#138461Purposelenti sgRNA cloning backbone with MS2 loops and EF1a-MCP-VP64DepositorInsertMCP-VP64-IRES-zsGreen1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1AAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189922PurposeAAV genome encoding SaABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e
UseAAVMutationSaCas9 D10APromoterEFSAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-SpCas9-HF1 (without sgRNA)
Plasmid#92102PurposeExpression plasmid for human codon-optimized high-fidelity SpCas9-HF1, px330-like backbone (without U6-sgRNA coding sequence)DepositorInsert3xFlag-NLS-Streptococcus pyogenes Cas9-HF1-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCK002_U6-Sa-sgRNA(mod)_EFS-SaCas9-2A-Puro_WPRE
Plasmid#85452PurposeLentiviral vector encoding modified SaCas9 system backbone bearing BsmBI site for new guide RNAs and puromycin selection marker.DepositorInsertU6-modified-sgRNA-Backbone-EFS-hSaCas9-2xNLS-2A-Puro
UseCRISPR and LentiviralTagsNLSExpressionMammalianAvailable SinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaKKHABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189923PurposeAAV genome encoding SaKKHABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVMutationnSaCas9 KKH, TadA ABE8e V106WPromoterEFSAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SauriABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189925PurposeAAV genome encoding SauriABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSauriABE8e
UseAAVMutationSauriCas9 D15APromoterEFSAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP
Plasmid#60955PurposeParental vector for the CRISPRi/a libraries. Expresses an sgRNA from the U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_puro optimized backbone
Plasmid#73797Purposeoptimized lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector
Plasmid#159281PurposeA multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)DepositorInsertAsCpf1-HA-2A-GFP
UseMulticistronic vector with both caggs promoter-dr…Tags3X HAExpressionMammalianPromoterU6Available SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTol2-hsp70l:Cas9-t2A-GFP, 5xU6:sgRNA
Plasmid#108871PurposeExpression of heat shock inducible Cas9-GFP and U6-driven 5 individual gRNAs for scGESTALT in zebrafishDepositorInserts5xU6:sgRNA
Cas9-t2A-GFP
UseCRISPRPromoterU6 and hsp70Available SinceApril 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingExpressionMammalianPromoterU1a and U6Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA Ef1alpha Puro-T2A-GFP
Plasmid#111596PurposesgRNA Ef1alpha Puro-T2A-GFPDepositorInsertmU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-Ezr sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179119PurposeExpresses Ezr sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertEzr sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1i
Plasmid#233080PurposeExpression vector for sgRNA-S1b and eCas12f1iDepositorInsertU6-sgRNA-S1b (BsaI)-Cbh-bpNLS-eCas12f1i-2xFLAG-P2A-EGFP
UseCRISPRTags2xFLAGExpressionMammalianPromoterhU6, CBhAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO5.U6.DR130(CasRX)_Non-targeting sgRNA.EFS.tRFP657
Plasmid#212962PurposeLentiviral plasmid for the measurement of RfxCas13d (CasRx) nuclease activity. As a marker, the plasmid also encodes the tRFP657 fluorescence protein.DepositorInsertDR1_CasRx_non-targeting spacer
UseCRISPR and LentiviralTagsTagRFP657ExpressionMammalianPromoterU6Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO5.U6.DR130(CasRX)_GFP-targeting sgRNA.EFS.tRFP657
Plasmid#212963PurposeLentiviral plasmid for the measurement of RfxCas13d (CasRx) nuclease activity. As a marker, the plasmid also encodes the tRFP657 fluorescence protein.DepositorInsertDR1_CasRx_GFP targeting spacer
UseCRISPR and LentiviralTagsTagRFP657ExpressionMammalianPromoterU6Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX601 miniCMV-SaCas9-SpA-sgRNA scaffold
Plasmid#107055PurposeBackbone vector for cloning in target sgRNA for use with SaCas9 (SauCas9)DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
B52 (empty plasmid backbone to express 2 sgRNAs)
Plasmid#100708PurposeEmpty plasmid backbone to express 2 sgRNAs (use BbsI and BsmBI for cloning)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEM047 [T7-assisted CROPseq sgRNA expression vector]
Plasmid#224899PurposeLentiviral CROP-seq vector with lineage barcode cassette and T7 promoter for ID amplification from cDNADepositorInsertseGFP
LacZ fragment (removed by digestion with BstXI/BlpI for sgRNA cloning)
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK- mRFP-T2A-PuroR
Plasmid#194925PurposemRFP and T2A linker are inserted in between the hPGK promoter and the puromycin resistance gene (PuroR) on pGL3-U6-sgRNA-PGK-puromycin to allow simultaneous monitoring and enrichment of transfected hoDepositorTypeEmpty backboneUseCRISPRPromoterhPGKAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti sgRNA NGFR GFP out of frame
Plasmid#155282PurposeLentiviral plasmid for sgRNA, NGFR marker, editing detected with GFP, used with 155280DepositorInsertGFP out of frame IRES NGFR
Available SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA BfuAI large stuffer
Plasmid#52628Purposelentiviral U6 driven sgRNA cloning vector where guide sequences are inserted between BfuAI sites, improved cassette cloning efficiencyDepositorInsertKanamycin cassette
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1
Plasmid#233078PurposeExpression vector for sgRNA-S1b and eCas12f1DepositorInsertU6-sgRNA-S1b (BsaI)-CBh-bpNLS-eCas12f1-2xFLAG-P2A-EGFP
UseCRISPRTags2xFLAGExpressionMammalianPromoterhU6, CBhAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA
Plasmid#158990PurposeVector G encodes pAAV-pCMV-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in mammalian cellsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpCMVAvailable SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDY156: SUZ12 px330 sgRNA Cas9 plasmid
Plasmid#170792PurposeThis plasmid encodes Cas9 and a sgRNA that targets the SUZ12 locus; to be used with pDY153DepositorInsertCas9
ExpressionMammalianAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRExpressionMammalianPromoterU6 and short human rhodopsin promoterAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
Plasmid#220493PurposeTo generate DNA-PKcs KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against DNA-PKcs exon 1.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP64-pU6-sgRNA
Plasmid#158972PurposeVector C encodes pAAV-pMecp2-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1a
Plasmid#233079PurposeExpression vector for sgRNA-S1b and eCas12f1aDepositorInsertU6-sgRNA-S1b (BsaI)-Cbh-bpNLS-eCas12f1a-2xFLAG-P2A-EGFP
UseCRISPRTags2xFLAGExpressionMammalianPromoterhU6, CBhAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-KRAB-pU6-sgRNA
Plasmid#158988PurposeVector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-KRAB
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLQ-Pxyl/tet-cas9-Pj23119-sgRNA
Plasmid#92121PurposeCRISPR-Cas9 based efficient genome editing in S. aureusDepositorInsertCas9-Pxyltet-sgRNA-pj23119
UseCRISPRExpressionBacterialAvailable SinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA
Plasmid#117687PurposeU6 driven Spy sgRNA cloning vector where guide sequences are inserted between BspMI sites. This plasmid works with Addgene #108570 for subnuclear proteomic profiling via C-BERST method.DepositorInsertsKanamycin cassette
TetR-P2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterU6 and hPGKAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI
Plasmid#189924PurposeAAV genome encoding SaABE8eV106W and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVMutationSaCas9 D10A, TadA ABE8e V106WPromoterEFSAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only