We narrowed to 4,733 results for: Gca
-
-
pPN094
Plasmid#91621PurposeExpress sgRNA targeting human GRIN2ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-H1-sgRNA-hTZAP
Plasmid#87186PurposeguideRNA targeting exon1 of human TZAPDepositorAvailable SinceMarch 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#2/Cre
Plasmid#193245PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgHcn1#2/Cre
Plasmid#193218PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Hcn1 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx1_gRNA2_dTet_NGFR
Plasmid#189801PurposeRetroviral delivery of guide RNA against mouse Runx1DepositorInsertgRunx1_gRNA2 (Runx1 Mouse)
UseRetroviralAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx1_gRNA1_dTet_NGFR
Plasmid#189802PurposeRetroviral delivery of guide RNA against mouse Runx1DepositorInsertgRunx1_gRNA1 (Runx1 Mouse)
UseRetroviralAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e3 and e7
Plasmid#190689PurposesgRNAs targeting enhancer 3 and 7 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 3 and 7 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKeap1#1/Cre
Plasmid#173639PurposeExpresses a Keap1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Keap1 (Keap1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC5 Tubb3-GFP KI
Plasmid#183440PurposeFlpOFF knock-in for beta3-tubulin GFP (amino acid position: stop codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-cdk2-guides
Plasmid#168250Purpose"neutrophil specific GFP with ubiquitous cdk2 sgRNAs"DepositorInsertcdk2 sgRNAs
UseCRISPRAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgAmpk1-hU6-sgAmpk2
Plasmid#177233PurposeExpresses Neomycin (bU6), Ampk1 (mU6) and Ampk2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgPrkaa1/sgPrkaa2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
COG4 shRNA
Plasmid#163861PurposeshRNA targeting the coding sequences of COG4DepositorInsertcomponent of oligomeric golgi complex 4 (COG4 Human)
ExpressionMammalianAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G3_Dual_sgRNA
Plasmid#173205PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
pZBTB9.1.0-gDNA
Plasmid#112469PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB9DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
gh42
Plasmid#106716Purposeexpression of gRNA targeting ST6GALNAC1DepositorInsertST6GALNAC1 (ST6GALNAC1 Human)
ExpressionMammalianAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_RXRB_2
Plasmid#104051PurposeEncodes gRNA for 3' target of human RXRB along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_2
Plasmid#73526PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro-shSF3B1
Plasmid#248800PurposeKnockdown of endogenous SF3B1 with shRNA targeting 3'UTRDepositorInsertshRNA targeting SF3B1 3'UTR
UseLentiviralPromoterhPGKAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-sgRNA048_Grb10
Plasmid#232934PurposeExpression vector for a sgRNA against the mouse Grb10 locus and SpCas9 with T2A-Puromycin resistance gene.DepositorInsertCas9-T2A-PuroR (Grb10 S. pyogenes)
ExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-1
Plasmid#223223Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_AAVS1_1801
Plasmid#159090Purposetargeting, non-essential locus controlDepositorInsertgRNA
UseLentiviralExpressionMammalianAvailable SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/GFP4_Seq1.3
Plasmid#206136PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1 (Col1a1 Mouse)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-HK2_sgRNA2
Plasmid#201597PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertHK2 (HK2 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgMYC guide 2
Plasmid#193597PurposecMYC knockoutDepositorInsertsgMYC guide 2 (MYC Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only
