173,361 results
-
Plasmid#109049PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-EGFP for RNA targetingDepositorInsertCasRx
UseCRISPR and LentiviralTags2A-eGFP, HA, and NLSExpressionMammalianPromoterEF1AAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
HIF-TRE-mStrawberry reporter
Plasmid#158681PurposeThis plasmid is a HIF1A pathway reporter. It has a 6 x HIF binding element promoter driving the expression of mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7-P2A-hMLH1dn
Plasmid#222997PurposeMammalian expression of SpCas9 PE7 prime editor with P2A-human MLH1dn (codon optimized)DepositorInsertPE7-P2A-hMLH1dn
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianMutationDeletion of residues 754-756 in MLH1 as described…PromoterCMVAvailable SinceAug. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pegRNA entry vector - pUC19-U6-[BsmBI_entry]-term (MNW320)
Plasmid#208977PurposeEntry vector for human U6 promoter driven SpCas9-based pegRNAs, comprised of hU6-[BsmBI]-terminator (spacer and RTT/PBS oligos must be cloned in)DepositorInsertpUC19-U6-[BsmBI]-term (pegRNA_entry_vector)
UseCRISPRTagsBPNLSExpressionMammalianPromoterhuman U6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUltra-hot
Plasmid#24130Purpose3rd generation Lentiviral vector for bi-cistronic expression of mCherry and the gene of interestDepositorTypeEmpty backboneUseLentiviralTagsmCherryExpressionMammalianAvailable SinceFeb. 26, 2010AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-Mito-7
Plasmid#54160PurposeLocalization: Mitochondria, Excitation: 487, Emission: 509DepositorAvailable SinceJune 16, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOPINE GFP nanobody
Plasmid#49172PurposeBacterial expression of GFP nano bodyDepositorInsertGFP nanobody
TagsHHHHHHExpressionBacterial and MammalianPromoterT7Available SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-Golgi eGFP
Plasmid#79809PurposeTo express and target GFP into the Golgi apparatus using lentivirusesDepositorInsertGolgi eGFP (B4GALT1 Human)
UseLentiviralTagsFusion of the first 62 amino acids of the human b…ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
AZ64_pE.DonorCLYBL.TS
Plasmid#199228PurposeDonor plasmid with CLYBL target sites for ITPN or HMEJ knock-in at the human CLYBL safe harbor locusDepositorInsertExpression unit for EGFP reporter
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19 - T7 pro - IRES - EGFP
Plasmid#138586PurposeExpress EGFP with an upstream T7 promoter in pUC19 backboneDepositorInsertEGFP
Available SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGreenIIM RPS5A-mDII-ntdTomato/RPS5A-DII-n3Venus
Plasmid#61629PurposeR2D2: Expresses a fusion of auxin-sensitive DII to nuclear 3xVenus and auxin-insensitive mDII to nuclear tdTomato, both from the Arabidopsis RPS5A promoterDepositorInsertsmDII
ntdTomato
DII
n3xVenus
ExpressionPlantPromoterRPS5AAvailable SinceMarch 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
ppyCAG_RNaseH1_WT
Plasmid#111906PurposeExpress RNASEH1 in mammalian cell.DepositorAvailable SinceJuly 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL4.27_ARE/NRF2-SPE
Plasmid#177775PurposeLuciferase reporter for ARE/NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseLuciferaseAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO mCherry (AAV Retrograde)
Viral Prep#114471-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-Ef1a-fDIO mCherry (#114471). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO mCherry plasmid DNA. Ef1a-driven, Flp recombinase-dependent expression of mCherry. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Flp-dependent)Available SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-Luc2-P2A-tdTomato
Plasmid#72486PurposeExpress Luc2 and tdTomato under EF1 promoterDepositorInsertLuc2-P2A-tdTomato
UseLentiviralExpressionMammalianPromoterEF1Available SinceJan. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-dCas9-BFP-KRAB
Plasmid#46911PurposeHuman expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS, tagBFP and a KRAB domainDepositorInsertdCas9-BFP-KRAB fusion
UseCRISPR and LentiviralTags2xNLS, BFP, HA, and KRAB domainExpressionMammalianPromoterSFFVAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-UTX
Plasmid#24168PurposeMammalian expression of human UTX with HA tagDepositorAvailable SinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-scramble
Plasmid#206924PurposePlasmid expressing Cas9, GFP and non-targeting guides for using as a control in CRISPR experimentsDepositorInsertnon-targeting human sgRNA guides
UseCRISPRPromoterU6Available SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-CamKIIa-jGCaMP8m-WPRE (AAV5)
Viral Prep#176751-AAV5PurposeReady-to-use AAV5 particles produced from AAV-CamKIIa-jGCaMP8m-WPRE (#176751). In addition to the viral particles, you will also receive purified AAV-CamKIIa-jGCaMP8m-WPRE plasmid DNA. CamKIIa-driven expression of calcium sensor GCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCamKIIalphaAvailable SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXR003: CasRx gRNA cloning backbone
Plasmid#109053PurposehU6-driven expression of guide RNAs compatible with CasRx. 5' processed DR followed by BbsI sites for guide cloning.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterhU6Available SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV_HyPer7RgDAAO
Plasmid#217653PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membraneDepositorInsertHyPer7 D amino acid oxidase
UseLentiviralTagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…PromoterCMVAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS
Plasmid#60904PurposeThe plasmid encodes a antibody that binds to the GCN4 peptide from the SunTag system, and is fused to a transcriptional activation domain VP64DepositorInsertscFv-GCN4
UseLentiviralExpressionMammalianAvailable SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
Tet1-dCas9
Plasmid#136650PurposeTet1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertTet1 (Tet1 Mouse)
UseCRISPRTags3XFLag-NLS-Tet1-dCas9-NLSExpressionMammalianPromoterCMVAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-ATLASsnFlp
Plasmid#232352PurposeAnterograde transsynaptic tracer protein to express in presynaptic glutamatergic neurons that express Cre, Flp payload. Must use with AAV8-fDIO-Reporter viruses infected in postsynaptic cells.DepositorHas ServiceAAV5 and AAV8InsertATLASsnFlp
UseAAVTagsALFA-TagPromoterhSynAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-15F11-HA-Halo
Plasmid#129592PurposeThe encoded protein is the anti-HA scFv (anti-HA frankenbody) fused with the HaloTag. It can be used to track mature and nascent HA tagged proteins in living organism.DepositorInsertAnti-HA frankenbody-HaloTag (15F11-HA scFv-HaloTag)
ExpressionMammalianPromoterCMVAvailable SinceAug. 15, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRTC2-puro
Plasmid#190567PurposeExpresses the full-length human L1 (L1.3) retrotransposon and an engineered neomycin retrotransposition reporter to monitor retrotransposition efficiency in cultured mammalian cells.DepositorInsertL1 (L1.3) with reporter cassette
ExpressionMammalianPromoterSV40Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
JNK-KTR-mStrawberry reporter
Plasmid#158689PurposeThis plasmid is a JNK pathway reporter. It has CMV promoter driving the expression of JNK-KTR fused to mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX458 V3
Plasmid#226957PurposeCBh-SpCas9-2A-GFP, and hU6-sgRNA (Sp) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only