We narrowed to 14,145 results for: TIM
-
Plasmid#188776PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9-mTagBFP2
UseLentiviralTagsHA-2xNLS-mTagBFP2 and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
8xNFAT-ZsG-hCD8
Plasmid#153417PurposeNFAT-driven ZsGreen-1 reporter gene with human CD8ab geneDepositorInsert8x of NFAT binding motif follwed by ZsGreen-1 fluorescent protein gene (Cd8a )
UseRetroviralExpressionMammalianAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a(His10-PD-1cyto)
Plasmid#177896PurposeE coli expression of His10 tag fused to human PD-1 Intracellular DomainDepositorInsertPD-1 (aa 194-288 only) (PDCD1 Human)
Tags10xHis-Thrombin cut site-T7 tagExpressionBacterialPromoterT7Available SinceMay 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABEmax-Puro V3
Plasmid#226956PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_ACh3.0
Plasmid#121923Purposeexpress the genetically-encoded fluorescent acethycholine(ACh) sensor GRAB-ACh3.0 in a cre-dependent mannerDepositorInsertGPCR activation based ACh sensor GRAB-ACh3.0
UseAAVPromoterhSynAvailable SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
hFLT1
Plasmid#83435Purposehuman VEGFR1 with HA and FLAG tagDepositorInserthuman VEGFR1 (FLT1 Human)
TagsFlag and MycExpressionMammalianMutationHA-tag was inserted 30 AA downstream of the FLT1 …PromoterCMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EF1a-Zim3-dCas9-BFP
Plasmid#188775PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9-mTagBFP2
UseLentiviralTagsHA-2xNLS-mTagBFP2 and Zim3 KRAB-NLS fusionPromoterEF1aAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CBE4max-SpCas9-NG-P2A-EGFP (RTW4554)
Plasmid#140001PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized CBE4max SpCas9-NG with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpCas9-NG=L1111R/D1135V/G1218R/E121…PromoterCAGAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Pdg459-eSp(1.1) V3
Plasmid#226965PurposeCBh-eSpCas9(1.1)-2A-Puro, and 2X hU6-sgRNA (Sp) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIA33
Plasmid#120803PurposeE. coli-C. difficile shuttle vector for CRISPR interference (CRISPRi) in C. difficile; sgRNA targets rfp; Pxyl::dCas9-opt Pgdh::sgRNA-rfpDepositorInsertsdeactivated nuclease dCas9, codon-optimized for C. difficile
single guide RNA targeting red fluorescent protein
UseCRISPRExpressionBacterialMutationBase-pairing region targets red fluorescent prote…PromoterPgdh and PxylAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJR101
Plasmid#187241PurposeLentiviral sgRNA vector for Perturb-seq with mU6 sgRNA promoter, CR1 constant region with CS1 capture sequence in stem loop, and UCOE EF1alpha driving PURO-GFP marker expressionDepositorInsertLentiviral sgRNA vector for Perturb-seq with mU6 promoter
UseLentiviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-hMIGA2-DsRed
Plasmid#192866PurposeExpress codon-optimized human MIGA2 full length with a C-terminal DsRed tag in mammalian cellsDepositorInsertCodon-optimized human Mitoguardin 2 (MIGA2 Human)
TagsDsRedExpressionMammalianPromoterCMVAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-PTRE-tight-flex-hM3Dq-mCherry-WPRE-pA
Plasmid#115161PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The hM3Dq receptor expression requires both neural activity and Cre recombinase.DepositorInsertsPTRE - tet activator responsive promoter
flex sequence
hM3dq-mCherry (inverted)
flex sequence
UseAAVTagshM3Dq-mCherryExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pC1-oROS-HT-CaaX
Plasmid#216417PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to the intracellular site of cell membranes.DepositorInsertoROS-HT-CaaX
ExpressionMammalianPromoterCMVAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-hTRF2
Plasmid#103804PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationhTRF2: deletion of amino acids 1-42 and 476 compa…PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pH-nCas9-PPE-V2
Plasmid#170131PurposeFor plant prime editing in rice plants or monocotyledons protoplastsDepositorInsertnCas9(H840A)-M-MLV
UseCRISPRExpressionPlantMutationH840A for Cas9; D200N, T306K, W313F, T330P and L…Promotermaize Ubiquitin-1, OsU3Available SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
PKD1 gRNA (BRDN0001148399)
Plasmid#76842Purpose3rd generation lentiviral gRNA plasmid targeting human PKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xFLAG-LigD-IRES-tdTomato
Plasmid#234951PurposeHuman codon optimized LigD (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInsertHuman codon optimized LigD with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsFLAGExpressionMammalianPromoterEF1AAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EF1a-Zim3-dCas9-P2A-GFP
Plasmid#188778PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterEF1aAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUltra-Chili-Luc
Plasmid#48688Purpose3rd generation Lentiviral vector with bi-cistronic expression of dtomato and luciferaseDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 EGFPC2 TAZ
Plasmid#66850PurposeExpress GFP-fused TAZ by lentivirusDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
mARGAna (cassette 1, transient)
Plasmid#197588PurposeSecond-generation mammalian acoustic reporter gene derived from AnabaenaDepositorInsertmARGAna (cassette 1)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2×FLAG-T4Lig-IRES-tdTomato
Plasmid#234952PurposeHuman codon optimized T4 DNA Ligase with N-terminal E1 MLS expressing plasmidDepositorInserthuman codon optimized T4 DNA Ligase with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsFLAGExpressionMammalianPromoterEF1aAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFN18A-HaloTag-Biotin
Plasmid#206039PurposeHaloTag-(Ig32)2-Talin R3-IVVI-(Ig32)2-10xHisTag-AviTagDepositorInsertTalin R3-IVVI (Tln1 Mouse)
Tags10 x His-AviTag and Halo-TagExpressionBacterialMutationThreonine 809 to Isoleucine, Threonine 833 to Val…PromoterT7Available SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO11-pcDNA3.1-
Plasmid#52501Purposeexpresses human FbxO11 in mammalian cells with FLAG-HA tag at N-terminusDepositorAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pB-TopFlash-NanoLucP
Plasmid#204347PurposeTopFlash reporterDepositorInsertTopFlash-NanoLucP
UseLuciferaseTagsNanoLucPPromoterminiPAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
fluoPEER-GFP>BFP
Plasmid#185477PurposeFluorescent reporter for a Y66H mutation to convert a GFP to BFP.DepositorInsertGFP-Y66-editing-site
ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX-SOUL-P2A-tdTomato-WPRE-BGHpA
Plasmid#177577PurposeExpresses SOUL in Cre-positive cellsDepositorInsertSOUL
UseAAVTagstdTomatoPromoterEF1aAvailable SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pROF148
Plasmid#155330PurposeBinary vector for expression of the PULSE system under the control of AtUbi10 promoter. It contains a plant selection cassette.DepositorInsertLB_Tnos-nptII-Pnos_PAtUbi10-SRDX-NLS-EL222-Tnos_PAtUbi10-E-PIF6-NLS-Tnos_PAtUbi10-PhyB-VP16-NLS-Tnos_RB
UseSynthetic BiologyExpressionPlantAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xMyc-Ku-IRES-Hygro
Plasmid#234950PurposeHuman codon optimized Ku (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInserthuman codon optimized Ku with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsMycExpressionMammalianPromoterEF1aAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBabe JUND-HA neo
Plasmid#58489Purposemammalian expression of human JUNDDepositorAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDF-5xT7-TtCsm
Plasmid#128572PurposeFor expression of T. thermophilus Csm in E. coli (Csm1-5)DepositorInsertsCsm1
Csm2, Csm3, Csm4, Csm5
TagsHRV 3C protease cleavage site and 10xHis tag on C…ExpressionBacterialMutationCodon optimized for expression in E. coli and Cod…PromoterT7 promoter, lac operatorAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
PDG459 V3
Plasmid#226958PurposeCBh-SpCas9-2A-Puro, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMVd1-NLS-GAL4-iLight-VP16-T2A-mTagBFP2
Plasmid#170273PurposeNLS-Gal4(1-65)-iLight(human codon optimized)-VP16-T2A-mTagBFP2 construct expression in mammalian cells.DepositorInsertNLS-Gal4(1-65)-iLight(human codon optimized)-VP16-T2A-mTagBFP2
ExpressionMammalianMutationSee CommentsPromoterCMVd1Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPI4-SNAP-CTLA-4-His6
Plasmid#223584PurposeProtein purification of human CTLA4 with SNAP and 6xHis tags from mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1-IMS-oROS-HT
Plasmid#216419PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to the inter-membrane-space of mitochondria.DepositorInsertoROS-HT
ExpressionMammalianPromoterCMVAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a(CTLA4)
Plasmid#177905PurposeBacterial expression of his10-tagged human CTLA4 Intracellular DomainDepositorInsertCTLA4 (aa 183-223 only) (CTLA4 Human)
Tags10xHis-Thrombin cut site-T7 tagExpressionBacterialPromoterT7Available SinceMay 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
R619-M66-303: CMV51p> HCoV-OC43 S-2P-T4f-3C-His8-Strep2x2
Plasmid#166015Purposemammalian expression of HCoV-OC43 soluble spike trimer proteinDepositorInsertHCoV-OC43 S (spike)
Tags3C-His8-Strep2x2ExpressionMammalianPromoterCMV51Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
YES1 gRNA (BRDN0001148961)
Plasmid#77967Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001145317)
Plasmid#77965Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001487120)
Plasmid#77966Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146880)
Plasmid#75912Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
R619-M91-303: CMV51p> HCoV-NL63 S-2P-T4f-3C-His8-Strep2x2
Plasmid#166017Purposemammalian expression of HCoV-NL63 soluble spike trimer proteinDepositorInsertHCoV-NL63 S (spike)
Tags3C-His8-Strep2x2ExpressionMammalianPromoterCMV51Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146194)
Plasmid#75913Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
R619-M90-303: CMV51p> HCoV-229E S-2P-T4f-3C-His8-Strep2x2
Plasmid#166016Purposemammalian expression of HCoV-229E soluble spike trimer proteinDepositorAvailable SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-SOUL-P2A-TdTomato-WPRE-hGH-polyA
Plasmid#177576PurposeExpresses SOUL in neuronal cell typesDepositorInsertSOUL
UseAAVTagstdTomatoPromoterhSynAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-dSV40-CTLA-4-mGFP
Plasmid#223594PurposeLentiviral expression of human CTLA4 with mGFP tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only