We narrowed to 5,654 results for: pCas
-
Plasmid#178858PurposeMammalian expression of PKCδ-eDHFR(69K6) chimera fused to miRFP670DepositorInsertPKCδ(1-229)-eDHFR(69K6)-PKCδ(280-675)-miRFP670 (PRKCD Human)
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_162 SpCas9 KES(1107-1109)GG
Plasmid#179526PurposeFor bacterial expression of SpCas9 KES(1107-1109)GG (phosphate lock loop mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 KES(1107-1109)GG
UseTags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationreplaced KES (residues 1107-1109) with GGPromoterAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Armc12 delta ARM/FLAG
Plasmid#180496PurposeExpression vector of ARM domain deleted mouse Armc12 tagged with FLAG at C-terminus. See Fig.4D of Shimada, K. et al. Proc. Natl. Acad. Sci. USA. 118 (6): e2018355118, 2021.DepositorInsertarmadillo repeat containing 12 (Armc12 Mouse)
UseTagsFLAG tagExpressionMammalianMutationARM domain of Armc12 is deletedPromoterCAG promoterAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-B2
Plasmid#165083PurposegRNA 2 of pair B for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C1
Plasmid#165085PurposegRNA 1 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C2
Plasmid#165086PurposegRNA 2 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dH85E-cs-TEV-STREP
Plasmid#171838PurposeMammalian expression of human WIPI2d H85E with N-terminal mCherry and C-terminal StrepDepositorInsertWIPI2d (WIPI2 Human)
UseTagsStrep and mCherryExpressionMammalianMutationH85EPromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dK88E-cs-TEV-STREP
Plasmid#171839PurposeMammalian expression of human WIPI2d K88E with N-terminal mCherry and C-terminal StrepDepositorInsertWIPI2d (WIPI2 Human)
UseTagsStrep and mCherryExpressionMammalianMutationK88EPromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dI92E-cs-TEV-STREP
Plasmid#171840PurposeMammalian expression of human WIPI2d I92E with N-terminal mCherry and C-terminal StrepDepositorInsertWIPI2d (WIPI2 Human)
UseTagsStrep and mCherryExpressionMammalianMutationI92EPromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dC93E-cs-TEV-STREP
Plasmid#171841PurposeMammalian expression of human WIPI2d C93E with N-terminal mCherry and C-terminal StrepDepositorInsertWIPI2d (WIPI2 Human)
UseTagsStrep and mCherryExpressionMammalianMutationC93EPromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dR108E-cs-TEV-STREP
Plasmid#171842PurposeMammalian expression of human WIPI2d with N-terminal mCherry and C-terminal StrepDepositorInsertWIPI2d (WIPI2 Human)
UseTagsStrep and mCherryExpressionMammalianMutationR108EPromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dR125E-cs-TEV-STREP
Plasmid#171843PurposeMammalian expression of human WIPI2d R108E with N-terminal mCherry and C-terminal StrepDepositorInsertWIPI2d (WIPI2 Human)
UseTagsStrep and mCherryExpressionMammalianMutationR125EPromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dK128E-cs-TEV-STREP
Plasmid#171844PurposeMammalian expression of human WIPI2d K128E with N-terminal mCherry and C-terminal StrepDepositorInsertWIPI2d (WIPI2 Human)
UseTagsStrep and mCherryExpressionMammalianMutationK128EPromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-PP-squirrel-monkey-CHMP3
Plasmid#154182Purposeexpresses squirrel monkey CHMP3 in mammalian cellsDepositorInsertCHMP3
UseTagsFLAG, Strep-Tag II, and preScission siteExpressionMammalianMutationPromoterCAGAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-PP-squirrel-monkey-retroCHMP3
Plasmid#154184Purposeexpresses squirrel monkey retroCHMP3 in mammalian cellsDepositorInsertretroCHMP3
UseTagsFLAG, Strep-Tag II, and preScission siteExpressionMammalianMutationPromoterCAGAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only