-
Plasmid#211978PurposeExpress gRNA against PDLIM1 with puro and BFPDepositorInsertsgRNA targeting PDLIM1 (PDLIM1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PDLIM1_Bru)-PGKpuroBFP-W
Plasmid#211979PurposeExpress gRNA against PDLIM1 with puro and BFPDepositorInsertsgRNA targeting PDLIM1 (PDLIM1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MYCN_5-3)-PGKpuroBFP-W
Plasmid#211972PurposeExpress gRNA against MYCN with puro and BFPDepositorInsertsgRNA targeting MYCN (MYCN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MYCN_5-4)-PGKpuroBFP-W
Plasmid#211973PurposeExpress gRNA against MYCN with puro and BFPDepositorInsertsgRNA targeting MYCN (MYCN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHES7-NLuc-2A-tdTomato
Plasmid#204348PurposeDonor vector to tag endogenous pig HES7 locusDepositorInsertNLuc-2A-tdTomato
UseTagsNanoLuc and tdTomatoExpressionMammalianMutationPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCOA-Leu-FvPPT1-fsr1
Plasmid#179868PurposeConstitutive expression vector for Saccharomyces cerevisiae comprising the polyketide synthase fsr1 from Fusarium vanettenii and the Fusarium verticillioides 4´-phosphopantetheinyltransferase PPT1DepositorInsertsPPT1
fsr1
UseTagsExpressionYeastMutationCodon optimized for expression in Saccharomyces c…PromoterYarrowia lipolytica EXP1 and Yarrowia lipolytica …Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV10-3xFLAG-prs-hMIGA2 (170-593)
Plasmid#192833PurposeExpress codon-optimized human MIGA2 fragment 170-593 in Expi293 cellsDepositorInsertCodon-optimized human Mitoguardin 2 (MIGA2 Human)
UseTags3xFLAG-PreScission cleavage siteExpressionMammalianMutationPromoterCMVAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Syn_Xph18_eGFP_CCR5TC
Plasmid#187443PurposeEncodes a specific PSD-95 binder (Xph18) fused to eGFP, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph18
UseAAVTagseGFPExpressionMammalianMutationPromoterSynapsinAvailable sinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Syn_Xph15_eGFP_CCR5TC
Plasmid#187442PurposeEncodes a specific PSD-95 binder (Xph15) fused to eGFP, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph15
UseAAVTagseGFPExpressionMammalianMutationPromoterSynapsinAvailable sinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iBSD-5LO-d4
Plasmid#182743PurposeLentiviral expression vector for codon-optimized 5-Lipoxygenase (isoform delta 4) in mamallian cells with blasticidin S resistance (bsd).DepositorInsert5-Lipoxygenase isoform delta 4 (ALOX5 Human)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationcodon optimized for expression in homo sapiensPromoterSFFVAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iBSD-5LO-d13
Plasmid#182745PurposeLentiviral expression vector for codon-optimized 5-Lipoxygenase (isoform delta 13) in mamallian cells with blasticidin S resistance (bsd).DepositorInsert5-Lipoxygenase isoform delta 13 (ALOX5 Human)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationcodon optimized for expression in homo sapiensPromoterAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-HsSyx3
Plasmid#179289PurposeE. coli expression plasmid (T7 promoter) for expression-optimized DNA of human Syx (aa 393-792) with N-terminal His6 + GFP + TEV protease cleavage siteDepositorInsertSyx
UseTagsHis6 + GFP + TEV protease cleavage siteExpressionBacterialMutationresidues 393-792 from accession number NP_0010361…PromoterT7Available sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB80-KIF1A(1-365)-GCN4-GFP-SSPB(micro)
Plasmid#174632PurposeHighly processive KIF1A for optogenetic heterodimerization to iLID via SSPB(micro)DepositorInsertKIF1A(1-365)-GCN4-GFP-SSPB(micro) (Kif1a Mouse, Synthetic)
UseTagsGFP-SSPB(micro)ExpressionMammalianMutationmmKIF1A(aa1-365): Pro202Ala; EGFP: Met1Del; SSPB:…PromoterChicken beta-actinAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC35A4_STOP
Plasmid#161289PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC35A4 (SLC35A4 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC26A9_STOP
Plasmid#161306PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC26A9 (SLC26A9 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC35A5_STOP
Plasmid#161277PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC35A5 (SLC35A5 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC22A31_STOP
Plasmid#161202PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC22A31 (SLC22A31 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC25A18_STOP
Plasmid#161169PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC25A18 (SLC25A18 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC24A3_STOP
Plasmid#161144PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC24A3 (SLC24A3 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC18 Apln5-HA-FlpO-pA-LoxP-PGK-Neo-pA-LoxP-Apln3 (SO89)
Plasmid#159222PurposeCan be used to target the mouse Apln locus in mouse eggs or ES cells, in order to drive the mosaic expression of the protein HA-NLS-FlpODepositorInsertApln 5'-FlpO-WPRE-Sv40pA-LoxP-PGK-Neo-pA-LoxP-Apln
UseTagsExpressionMammalianMutationPromoterAplnAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-mPGK-CD3-P2A-CD90.2
Plasmid#163337PurposeRetroviral vector to overexpress the murine CD3 (TCR) components CD3 gamma, CD delta, CD epsilon and TCR zeta and surface marker CD90.2, separated by T2; F2A; E2A; P2A respectively, under control of the mPGK promoterDepositorInsertCD3
UseRetroviralTagsExpressionMammalianMutationPromotermPGKAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hFTH1-CD3-P2A-CD90.2
Plasmid#163335PurposeRetroviral vector to overexpress the murine CD3 (TCR) components CD3 gamma, CD delta, CD epsilon and TCR zeta and surface marker CD90.2, separated by T2; F2A; E2A; P2A respectively, under control of the hFTH1 promoterDepositorInsertCD3
UseRetroviralTagsExpressionMammalianMutationPromoterhFTH1Available sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT7
Plasmid#127515PurposePlasmid encodes H. sapiens codon optimized Integrase 7.DepositorInsertIntegrase 7 coding sequence codon optimized for H. sapiens expression.
UseTagsExpressionMammalianMutationIn 2126 position an G mutated for an T changed th…PromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v5
Plasmid#145152PurposeMammalian expression plasmid for soluble ACE2 (protease domain) high affinity variant 5DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2-T92Q
Plasmid#145156PurposeMammalian expression plasmid for soluble ACE2 (protease domain) T92Q glycosylation mutantDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseTagsExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
289aa ELL2
Plasmid#127266PurposeFor in vitro translation of shorter human ELL2 from Met1. Also contains Met133I, M1381I, M186I mutations.DepositorInsertNH2-ELL2 (Met133ILeu, M1381ILeu, M186ILeu) (ELL2 Human)
UseIn vitro translationTagsExpressionMutationThree Mets (133, 138, 186) to Ileu. Contains 289…PromoterT7Available sinceJuly 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Xba ELL2 Met133, 138, 186 to Ileu
Plasmid#127269PurposeFor in vitro translation of ELL2 with with internal HA tag and Met133, 138, 186 IleuDepositorInsertELL2 Met133, 138, 186 to Ileu (ELL2 Human)
UseIn vitro translationTagsExpressionMutationMet133, 138, 186 to Ileu HA tag after M186PromoterT7Available sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Sph ELL2 Met133, 138, 186 to Ileu
Plasmid#127271PurposeFor in vitro translation of human ELL2 with Met133, 138, 186 to Ileu with HA tag after 8th MetDepositorInsertELL2 Met133, 138, 186 to Ileu (ELL2 Human)
UseIn vitro translationTagsExpressionMutationMet133, 138, 186 to Ileu with HA tag after 8th MetPromoterT7Available sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged mid ELL2 M133, 138, 186ILeu
Plasmid#127276PurposeExpresses human ELL2 with M133, 138, 186ILeu to prevent internal Met initiation peptides and contains middle HA tag that doesn't disrupt functionDepositorInsertELL2 (ELL2 Human)
UseTagsExpressionMammalianMutationM133, 138, 186 to Ileu, HA tag at XbaI after Met …PromoterpEF1aAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q03JI6
Plasmid#103123PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ03JI6 (Cas9 coding gene from Campylobacter jejuni)
UseCRISPR; Cloning vectorTagsSV40NLSExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
RV-cag-Dio-Kif5c-2A-tdt
Plasmid#87668Purposeretroviral vector, conditional expression membrane Tdtomato and Kif5Cdelta560DepositorInsertKif5C-P2A-mTdt (Kif5c Rat)
UseRetroviralTagspalmitylationExpressionMutationmotor domain aa1-560 present, V40A, E125V (see de…PromoterCAGAvailable sinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
NPR2 gRNA (BRDN0001148355)
Plasmid#77753Purpose3rd generation lentiviral gRNA plasmid targeting human NPR2DepositorInsertNPR2 (NPR2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
IPMK gRNA (BRDN0001146121)
Plasmid#78075Purpose3rd generation lentiviral gRNA plasmid targeting human IPMKDepositorInsertIPMK (IPMK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCK gRNA (BRDN0001148859)
Plasmid#78057Purpose3rd generation lentiviral gRNA plasmid targeting human DCKDepositorInsertDCK (DCK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCK gRNA (BRDN0001487070)
Plasmid#78058Purpose3rd generation lentiviral gRNA plasmid targeting human DCKDepositorInsertDCK (DCK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CKM gRNA (BRDN0001487098)
Plasmid#78031Purpose3rd generation lentiviral gRNA plasmid targeting human CKMDepositorInsertCKM (CKM Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CKM gRNA (BRDN0001148014)
Plasmid#78028Purpose3rd generation lentiviral gRNA plasmid targeting human CKMDepositorInsertCKM (CKM Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CKM gRNA (BRDN0001146579)
Plasmid#78029Purpose3rd generation lentiviral gRNA plasmid targeting human CKMDepositorInsertCKM (CKM Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CKM gRNA (BRDN0001148653)
Plasmid#78030Purpose3rd generation lentiviral gRNA plasmid targeting human CKMDepositorInsertCKM (CKM Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LMTK3 gRNA (BRDN0001487159)
Plasmid#77993Purpose3rd generation lentiviral gRNA plasmid targeting human LMTK3DepositorInsertLMTK3 (LMTK3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FN3KRP gRNA (BRDN0001146806)
Plasmid#78001Purpose3rd generation lentiviral gRNA plasmid targeting human FN3KRPDepositorInsertFN3KRP (FN3KRP Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FN3KRP gRNA (BRDN0001145144)
Plasmid#78002Purpose3rd generation lentiviral gRNA plasmid targeting human FN3KRPDepositorInsertFN3KRP (FN3KRP Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FN3KRP gRNA (BRDN0001144933)
Plasmid#78003Purpose3rd generation lentiviral gRNA plasmid targeting human FN3KRPDepositorInsertFN3KRP (FN3KRP Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FN3KRP gRNA (BRDN0001487148)
Plasmid#78004Purpose3rd generation lentiviral gRNA plasmid targeting human FN3KRPDepositorInsertFN3KRP (FN3KRP Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ACVR2A gRNA (BRDN0001487105)
Plasmid#77930Purpose3rd generation lentiviral gRNA plasmid targeting human ACVR2ADepositorInsertACVR2A (ACVR2A Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ACVR2A gRNA (BRDN0001148374)
Plasmid#77931Purpose3rd generation lentiviral gRNA plasmid targeting human ACVR2ADepositorInsertACVR2A (ACVR2A Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAK1 gRNA (BRDN0001146970)
Plasmid#77935Purpose3rd generation lentiviral gRNA plasmid targeting human AAK1DepositorInsertAAK1 (AAK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAK1 gRNA (BRDN0001487093)
Plasmid#77936Purpose3rd generation lentiviral gRNA plasmid targeting human AAK1DepositorInsertAAK1 (AAK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAK1 gRNA (BRDN0001149078)
Plasmid#77937Purpose3rd generation lentiviral gRNA plasmid targeting human AAK1DepositorInsertAAK1 (AAK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only