169,691 results
-
Plasmid#158686PurposeThis plasmid is a ERK pathway reporter. It has CMV promoter driving the expression of ERK-KTR fused to mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDB5318
Plasmid#204828PurposeAn integrating plasmid containing both the inducible enotetS promoter and the coding sequence of the TetR repressor under the control of the constitutive CMV promoter.DepositorInsertstetR
mECitrine
ExpressionYeastPromoterCMV promoter and enotetS promoterAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLminP_Luc2P_RE25
Plasmid#90367PurposeNotch - NIDC/CBF1 gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterNotchAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-mtagBFP-2A RIGI WT
Plasmid#167289PurposeLentiviral expression construct encoding a TagBFP in frame with a self-cleaving wild-type RLR sensor RIG-IDepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LV-TRE-VP64 mouse MyoD-T2A-dsRedExpress2
Plasmid#60625PurposeExpresses VP64 mouse MyoD and dsRedExpress2 in response to doxycyclineDepositorInsertVP64 mouse MyoD
UseLentiviralPromoterTREAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAX198
Plasmid#173042PurposeCustom vector for sgRNA library constructionDepositorInsertHBB Gene - Second and third exons of ENST00000647020.1 (no intron) and part of the 3' UTR (HBB Human)
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHDM-VSV-G
Plasmid#164440PurposeEncodes VSV-G protein for pseudovirus productionDepositorInsertVSV-G
ExpressionMammalianAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-smURFP-RBS-HO-1
Plasmid#80341PurposeExpresses smURFP and Heme Oxygenase-1 in bacterial cells.DepositorInsertssmURFP
HO-1
Tags6 Histidine TagExpressionBacterialPromoterpBADAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
ptf-Galectin3
Plasmid#64149PurposeExpression in mammalian cellsDepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
P4-PE
Plasmid#211375PurposePackaging plasmid for v3b PE-eVLP productionDepositorInsertP4-PE
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pY010 (pcDNA3.1-hAsCpf1)
Plasmid#69982PurposeExpresses humanized AsCpf1DepositorInserthAsCpf1
UseCRISPRTagsNLS-3xHAExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGAselect
Plasmid#195714PurposepGGAselect is a cloning vector for Golden Gate Assembly using BsaI, BsmBI, and BbsI Type IIS restriction enzymes.DepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAG-GCaMP6s
Plasmid#171156PurposeEncodes GCaMP6sDepositorInsertGCaMP6s
ExpressionMammalianAvailable SinceAug. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hLAMP2-C-GC6s
Plasmid#154151PurposeTo detect the calcium ion releases close to the lysosomal surfaceDepositorAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-myriRFP670V5-P2A-post-eGRASP
Plasmid#111585PurposeAn AAV vector that expresses double floxed myristoylated iRFP670 with V5 tag and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyriRFP670V5-P2A-post-eGRASP
UseAAVPromoterEf1aAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-BRD4ΔN-mCherry-sspB
Plasmid#121968PurposeExpresses fusion of disordered protein BRD4(462-1362), fluorescent protein mCherry, and sspB which upon light activation binds to iLID.DepositorInsertBRD4 (BRD4 Human)
UseLentiviralTagsmCherry-sspBExpressionMammalianMutationDeleted amino acids 1-461PromoterSFFVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRPML1-YFP
Plasmid#18826DepositorAvailable SinceJuly 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
FLT3-MSCV-IRES-GFP
Plasmid#184778PurposeExpresses wildtype FLT3 in mammalian cellsDepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNBU2_erm-TetR-P1T_DP-GH023
Plasmid#90324PurposeIntegration vector at an attB site in Bacteroides; contains 1kb cassette with both the P1T_DP aTC-inducible promoter (RBS GH023) and the consitutively-driven TetR by the P2-A21 promoterDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
EF1a_CDX2_P2A_Hygro_Barcode
Plasmid#120432PurposeBarcoded lentiviral vector to express CDX2 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shRNA E-cadherin
Plasmid#18801DepositorAvailable SinceJuly 22, 2008AvailabilityAcademic Institutions and Nonprofits only -
pTol2-HuC(elavl3)-CaMPARI2
Plasmid#137185Purposepan-neuronal expression of CaMPARI2 in zebrafish, used to generate the CaMPARI2 zebrafish line at ZIRC (ZL13801)DepositorInsertHuC(elavl3)-CaMPARI2-FLAG-HA-myc-polyA
UseTol2 plasmid for zebrafishTagsFLAG, HA, mycPromoterHuC(elavl3)Available SinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-JMJD2B
Plasmid#24181PurposeMammalian expression of human JMJD2B with HA tagDepositorAvailable SinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HA Arf6 ActQ67L
Plasmid#10835DepositorInsertArf6 Q67L (ARF6 Human)
TagsHAExpressionMammalianMutationQ67L. Defective in GTP hydrolysis. Constitutive…Available SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v6 (fl)
Plasmid#137816Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v6 (fl) (CD44 Human)
TagsGFPExpressionMammalianMutationR296K in the V6 region [Please see depositor comm…PromoterPGKAvailable SinceJune 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
CMV-Sp1
Plasmid#12097DepositorAvailable SinceAug. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLS-mP
Plasmid#81225PurposeLentivirus enhancer assay plasmid that contains a minimal promoter (mP) and a EGFP reporter gene.DepositorTypeEmpty backboneUseLentiviralPromoterDerived from pGL4.23Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a-sfGFP
Plasmid#85492PurposepET28a expressing codon optimized superfolder GFP with C-terminal His6 tagDepositorInsertsuperfolder GFP
Tags6x HisExpressionBacterialPromoterT7Available SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPM1c-C1
Plasmid#131821PurposeExpresses HcRed-NPM1c (cytoplasmic mutant, human) in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsHcRedExpressionMammalianMutationThis is the cytoplasmic mutant causing AML, where…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only