We narrowed to 10,133 results for: gnas
-
Plasmid#211364PurposeLentiviral expression vector for an insert of interest linked to a P2A-T2A puromycin sequence. Produces virus very efficiently. Can also be used for regular transfectionsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pGS_101
Plasmid#160541PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBa-LSS-GFP-LDLR wt
Plasmid#98184PurposeLow Density Lipoprotein Receptor N-terminally tagged with Green Fluorescent Protein. LSS= LDLR signal sequence, which is cleaved leaving the GFP attached to the mature LDLR protien.DepositorInsertLDLR (LDLR Human)
TagsGFP and LDLR signal sequence, N-term of GFP so GF…ExpressionMammalianMutationnonePromoterChicken Beta ActinAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGS_128
Plasmid#160651PurposeExpresses Human APOE3 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e3 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione3 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGS_107
Plasmid#160650PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGS_129
Plasmid#160652PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-HA-AT1R-YFP
Plasmid#101659PurposeExpresses AT1R with HA tag and YFP in mammalian cells.DepositorInsertAngiotensin II type 1 receptor (AGTR1 Human)
TagsHA and YFP (Venus)ExpressionMammalianPromoterCAG promoterAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mTagBFP2-CAAX2 WPRE
Plasmid#236231PurposeAAV expression of a fluorescent marker, mTagBFP2, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmTagBFP2 fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmTagBFP2Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP(ABC1D)-2pabPAC(F198Y)
Plasmid#234548Purposeto express a version with reduced constitutive activity (thanks to point mutation F198Y) of the optogenetic tool 2pabPAC, which increases cAMP levels when stimulated by blue light, in astrocytesDepositorInsert2pabPAC(F198Y)
UseAAVMutationF198YPromotermGFAP(ABC1D)Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-TGFb1
Plasmid#101762PurposeTGFb1 promoter reporterDepositorAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-AREG-ScNeo
Plasmid#209897PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
IGF1R_pLX307
Plasmid#98344PurposeLentiviral expression of IGF1RDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDest-1.7kbfabp6-eGFP-pA-CrymCherry
Plasmid#159088PurposeLR construct using backbone with Cry:mCherry insert to identify fish with transgene, and with p5E-1.7kbfabp6, pME-eGFP, and p3E-pA insertsDepositorInsertsUseFluorescent reporterPromoter1.7kb fabp6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
Human Wild-type ASAP1
Plasmid#235212PurposeExpresses Wild-Type ASAP1 in mammalian cellsDepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUltra-Hot-PC
Plasmid#184466PurposeLentiviral vector for bi-cistronic expression of mCherry and PC (seperated by P2A)DepositorAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_4x(U6 tRNA M15)_CMV NESPylRS(AF)
Plasmid#182652PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF) & 4x M15 tRNACUA used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
4xU6-tRNAM15
Tagsnuclear export signal (NES)ExpressionMammalianMutationY306A/Y384F (AF) double mutant of Methanosarcina …PromoterCMV and U6Available SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCC336
Plasmid#110167PurposeminiMos vector expresses ERKKTR(S43E,T55E,T62E)-mClover and mCherry-H2B in C. elegans VPCs; use as control for pCC324 (Contains Neomycin resistance)DepositorInsertERK-KTR(S43E,T55E,T62E)-mClover-T2A-mCherry-H2B
UseMinimos transposonTagsmCherry and mCloverExpressionWormMutationPhospho-acceptor sites mutated: S43E, T55E, T62E.…Promoterlin-31 promoter/enhancerAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCC335
Plasmid#110166PurposeminiMos vector expresses ERKKTR(S43A,T55A,T62A)-mClover and mCherry-H2B in C. elegans VPCs; use as control for pCC324 (Contains Neomycin resistance)DepositorInsertERK-KTR(S43A,T55A,T62A)-mClover-T2A-mCherry-H2B
UseMinimos transposonTagsmCherry and mCloverExpressionWormMutationPhospho-acceptor sites mutated: S43A, T55A, T62A.…Promoterlin-31 promoter/enhancerAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-N-3XFLAG-Gsk3b
Plasmid#123592DepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-FoxO1_1R_10A_3D
Plasmid#106278PurposeFluorescent fusion protein for FoxO1DepositorInsertsTagsClover fluorescent proteinExpressionMammalianMutationDeleted amino acids 401-636, S209A, H212R, S215A,…PromoterEF1a/RPBSAAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
TGFB1_pLX307
Plasmid#98377PurposeLentiviral expression of TGFB1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-NR4A1-P2A-mCherry
Plasmid#203859PurposeTet-inducible lentiviral plasmid expressing NR4A1-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertNR4A1 (NR4A1 Human)
ExpressionMammalianAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-ZEB2-P2A-mCherry
Plasmid#203857PurposeTet-inducible lentiviral plasmid expressing ZEB2-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertZEB2 (ZEB2 Human)
ExpressionMammalianAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-UbC-Blast-2A-STING-mNeonGreen
Plasmid#227185PurposeLentiviral expression plasmid encoding STING-mNeonGreen under UbC promoterDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-eHGT_78h-Cre_PEST
Plasmid#231791PurposeExpresses Cre in excitatory neurons; Cre expression is attenuated by PEST sequence.DepositorInsertCre
UseAAVTagsPESTPromoterminBetaGlobinAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-hPGK-Blast-2A-STING-TurboID
Plasmid#204713PurposeExpresses C-terminal TurboID tagged human STING for proximity ligation.DepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
FAS_pLX307
Plasmid#98334PurposeLentiviral expression of FASDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP-mVenus-TOSI
Plasmid#172491PurposemVenus-TOSI (TOr-Signal-Indicator) is a fluorescent reporter for mTORC1 signaling (monitoring PDCD4 degradation) which can be introduced to mammalian cells by retrovirus vector.DepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
IQGAP1_pLX307
Plasmid#98346PurposeLentiviral expression of IQGAP1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX LYCHOS-FLAG-TiD
Plasmid#199747PurposeLentiviral construct to stably express LYCHOS (GPR155) TurboIDDepositorAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-PABPC1
Plasmid#232944PurposeExpresses PABPC1 proteinDepositorInsertPABPC1 (PABPC1 Human)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20-Tau
Plasmid#92201PurposeRetroviral overexpression vector (doxycycline-inducible) for TauDepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-eGFP-NLS-RNF168 delta RING
Plasmid#133983Purposemammalian expression vector of eGFP tagged RNF168 where the N-terminus of RNF168 has been deleted (including RING domain)DepositorInsertRNF168 (RNF168 Human)
TagseGFPExpressionMammalianMutationdeletion of RING; siRNA resistant sequence: GAGGA…PromoterCMVAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMXs-IP-mCherry-TOSI
Plasmid#172496PurposemCherry-TOSI (TOr-Signal-Indicator) is a fluorescent reporter for mTORC1 signaling (monitoring PDCD4 degradation) which can be introduced to mammalian cells by retrovirus vector.DepositorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-AREG-ScNeo
Plasmid#209910PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ALK6 K231R
Plasmid#80884Purposemammalian expression of ALK6 K231RDepositorInsertALK6 (Bmpr1b Mouse)
TagsHAExpressionMammalianMutationK231R (kinase-deficient)PromoterCMVAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N3-EPAC1
Plasmid#113110PurposeHuman EPAC1 gene was fused in-frame and upstream from the enhanced YFP gene in pEYFP-N3 vector (Clonetech).DepositorAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
BRAF_pLX307
Plasmid#98322PurposeLentiviral expression of BRAFDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA.3.1.ADRB2-NP
Plasmid#134376PurposeNanoluc complementation assay. Expression of adrenoceptor beta 2 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of signal sequence and Flag epitope at N terminus of ADRB2.DepositorInsertADRB2-NP (ADRB2 Human)
TagsFlag, natural peptide of nanoluciferase, and sign…ExpressionBacterial and MammalianPromoterT7Available SinceAug. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-EF1α-mKate2-PDE4D3-Cat
Plasmid#169128PurposeAAV plasmid containing a mKate2 and a truncated PDE4D3DepositorHas ServiceAAV1InsertmKate2-PDE4DCatL (PDE4D Human)
UseAAV and Cre/LoxTagsmKate2ExpressionMammalianMutationtruncated, Catalatic domain onlyPromoterEF1aAvailable SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIGAhRC
Plasmid#112510Purposehuman Ah receptor and Arnt cDNAs expressed under control of Gal1,10 bidirectional promoterDepositorUseSynthetic BiologyExpressionYeastPromoterGal1,10Available SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
BCL2L1_pLX307
Plasmid#98323PurposeLentiviral expression of BCL2L1DepositorAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-FLAG-KORD-P2A-3xHA-hM3D(Gq)
Plasmid#220611PurposeNeuron-specific, Cre-dependent co-expression of FLAG-tagged inhibitory KORD DREADD receptor, and 3x HA-tagged excitatory hM3D(Gq) DREADD receptor.DepositorInsertFLAG-KORD-P2A-3x HA-hM3D(Gq)
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterhSynAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P1-6A
Plasmid#51248PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907,980,1006 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907,980,1006 mutated to A…PromoterEF1aAvailable SinceMarch 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-FLAG-KORD-P2A-ArgiNLS-AausFP1
Plasmid#220612PurposeCre-dependent co-expression of FLAG-tagged inhibitory KORD DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-KORD-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-Blast-DNTGFBR2-HA
Plasmid#130888PurposeExpresses dominant negative mutant human TGFBR2DepositorInsertTGFBR2 (TGFBR2 Human)
TagsHA-tagExpressionMammalianMutationDominant Negative receptor lacking cytosolic cata…PromoterCMVAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
APOE_pLX307
Plasmid#98317PurposeLentiviral expression of APOEDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
GCH1_pLX307
Plasmid#98336PurposeLentiviral expression of GCH1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only